\
| Variant ID: vg0232543553 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32543553 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTGAAATTCCAAAATGGCAAAAGGCAGCATTATTTACACAATACACAGGCCTTAGGGTACGCTCATTTCAGCTTATAGGATTAGATTCTCCTCGTTTTC[C/T]
GTTAGCACGTTTTTCAAACTGCTAAACGGTATATTTCGTACGAAAACTTTCTATAAAGAAGTTATTTAAAAAAATCCAAGAAATTTATTCATCAAAAATT
AATTTTTGATGAATAAATTTCTTGGATTTTTTTAAATAACTTCTTTATAGAAAGTTTTCGTACGAAATATACCGTTTAGCAGTTTGAAAAACGTGCTAAC[G/A]
GAAAACGAGGAGAATCTAATCCTATAAGCTGAAATGAGCGTACCCTAAGGCCTGTGTATTGTGTAAATAATGCTGCCTTTTGCCATTTTGGAATTTCAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.80% | 2.00% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 93.40% | 6.00% | 0.60% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 89.40% | 9.50% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232543553 | C -> T | LOC_Os02g53160.1 | upstream_gene_variant ; 1456.0bp to feature; MODIFIER | silent_mutation | Average:58.394; most accessible tissue: Minghui63 root, score: 81.681 | N | N | N | N |
| vg0232543553 | C -> T | LOC_Os02g53169.1 | upstream_gene_variant ; 2368.0bp to feature; MODIFIER | silent_mutation | Average:58.394; most accessible tissue: Minghui63 root, score: 81.681 | N | N | N | N |
| vg0232543553 | C -> T | LOC_Os02g53160-LOC_Os02g53169 | intergenic_region ; MODIFIER | silent_mutation | Average:58.394; most accessible tissue: Minghui63 root, score: 81.681 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232543553 | 9.32E-06 | 9.32E-06 | mr1914 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | 4.77E-07 | 4.77E-07 | mr1158_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | 2.80E-06 | 2.80E-06 | mr1186_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | NA | 3.26E-06 | mr1321_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | 3.27E-07 | 3.27E-07 | mr1371_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | NA | 5.64E-06 | mr1380_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | 4.33E-06 | 4.33E-06 | mr1445_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | 2.55E-07 | 2.55E-07 | mr1499_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | 4.88E-06 | 4.88E-06 | mr1616_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | 9.31E-07 | 9.31E-07 | mr1647_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | NA | 6.50E-06 | mr1706_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | NA | 2.18E-06 | mr1712_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | 4.18E-07 | 3.42E-08 | mr1946_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | 4.18E-07 | 3.42E-08 | mr1948_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232543553 | NA | 3.09E-07 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |