Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232486002:

Variant ID: vg0232486002 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32486002
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCGTCGGCCGGTCAGACCGCGGGCTGGCCGGTCTGACCGCTCGATCACCACCGGTCTGACCGGCATACACCACCTAGTCGGACCGGTCACATAAAATAA[T/C]
AGTGAATCCGATCATCACCTGAAAATTGATTATCTCCAAAACCACTTCGACGATAATCTCCAAATATCAAAACCAATAATCACAGATGTCAATTGTTCAT

Reverse complement sequence

ATGAACAATTGACATCTGTGATTATTGGTTTTGATATTTGGAGATTATCGTCGAAGTGGTTTTGGAGATAATCAATTTTCAGGTGATGATCGGATTCACT[A/G]
TTATTTTATGTGACCGGTCCGACTAGGTGGTGTATGCCGGTCAGACCGGTGGTGATCGAGCGGTCAGACCGGCCAGCCCGCGGTCTGACCGGCCGACGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.90% 0.04% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 91.10% 8.80% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 86.70% 13.20% 0.13% 0.00% NA
Tropical Japonica  504 97.40% 2.60% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232486002 T -> C LOC_Os02g53100.1 upstream_gene_variant ; 3015.0bp to feature; MODIFIER silent_mutation Average:41.805; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0232486002 T -> C LOC_Os02g53090.1 intron_variant ; MODIFIER silent_mutation Average:41.805; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232486002 5.12E-06 5.12E-06 mr1041_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 6.69E-07 6.69E-07 mr1158_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 5.46E-06 5.46E-06 mr1184_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 1.16E-06 1.16E-06 mr1186_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 1.72E-07 1.72E-07 mr1371_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 NA 4.36E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 1.47E-06 1.47E-06 mr1494_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 1.39E-08 1.39E-08 mr1499_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 2.43E-07 2.43E-07 mr1616_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 8.48E-06 8.48E-06 mr1645_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 1.18E-06 1.18E-06 mr1647_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 1.45E-06 1.45E-06 mr1648_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 4.57E-06 4.57E-06 mr1876_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 6.90E-06 8.14E-08 mr1946_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 6.90E-06 8.14E-08 mr1948_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232486002 5.64E-07 5.45E-09 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251