\
| Variant ID: vg0232481675 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32481675 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTTGAGCATTTTTGCTCATATTTTTCTCTTTTTATTCCGGGTACGTCCCTGTCATCAAGACTGTTTCTAGGGATTCGGCACCCATTATTTTGCTCACATC[G/A]
AATACGTCCTTGTCGTCAAGACTGTTTCCAAGGATTCGGTATTTATTTTTTTCTCATATTTTTATTCTGTTTTTCACAATGAGCAATTAAAGCTATTTGA
TCAAATAGCTTTAATTGCTCATTGTGAAAAACAGAATAAAAATATGAGAAAAAAATAAATACCGAATCCTTGGAAACAGTCTTGACGACAAGGACGTATT[C/T]
GATGTGAGCAAAATAATGGGTGCCGAATCCCTAGAAACAGTCTTGATGACAGGGACGTACCCGGAATAAAAAGAGAAAAATATGAGCAAAAATGCTCAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 2.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 91.30% | 8.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 86.80% | 13.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 6.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232481675 | G -> A | LOC_Os02g53090.1 | downstream_gene_variant ; 1720.0bp to feature; MODIFIER | silent_mutation | Average:14.757; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0232481675 | G -> A | LOC_Os02g53080-LOC_Os02g53090 | intergenic_region ; MODIFIER | silent_mutation | Average:14.757; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232481675 | NA | 3.08E-06 | mr1296_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | 3.98E-06 | 3.98E-06 | mr1371_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | 6.03E-06 | 6.03E-06 | mr1494_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | NA | 9.22E-06 | mr1499_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | 4.22E-07 | 4.22E-07 | mr1499_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | 2.11E-06 | 2.11E-06 | mr1616_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | 6.33E-06 | 6.33E-06 | mr1876_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | NA | 3.40E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | 1.35E-09 | 1.67E-11 | mr1946_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | NA | 1.45E-07 | mr1946_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | 1.35E-09 | 1.67E-11 | mr1948_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | NA | 1.45E-07 | mr1948_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | 5.38E-06 | 9.85E-08 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232481675 | 3.73E-06 | 8.35E-08 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |