\
| Variant ID: vg0232480149 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32480149 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAACTTTATTACTTCTCTCTGTGTTTACAAAGTGCACCAACATCACTCCTTACAAAAATCTTGACTAAACTCGAAACCCTAACTAAACTAGCAACTCAAT[A/T]
GCTCTCAAAAGCGATACCGGGAAGCCTCACGCTCCCCCTCTATTTATACATGATGTAGGCAGCCTAAAGCCACGAACCAAACTCATACTAAGAGTCCTAA
TTAGGACTCTTAGTATGAGTTTGGTTCGTGGCTTTAGGCTGCCTACATCATGTATAAATAGAGGGGGAGCGTGAGGCTTCCCGGTATCGCTTTTGAGAGC[T/A]
ATTGAGTTGCTAGTTTAGTTAGGGTTTCGAGTTTAGTCAAGATTTTTGTAAGGAGTGATGTTGGTGCACTTTGTAAACACAGAGAGAAGTAATAAAGTTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 30.70% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 1.40% | 1.01% | 0.00% | NA |
| All Japonica | 1512 | 9.70% | 90.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 1.00% | 1.68% | 0.00% | NA |
| Indica II | 465 | 97.00% | 2.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 97.90% | 1.00% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 1.80% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 13.30% | 86.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232480149 | A -> T | LOC_Os02g53080.1 | upstream_gene_variant ; 3966.0bp to feature; MODIFIER | silent_mutation | Average:30.493; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg0232480149 | A -> T | LOC_Os02g53080.2 | upstream_gene_variant ; 4021.0bp to feature; MODIFIER | silent_mutation | Average:30.493; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg0232480149 | A -> T | LOC_Os02g53090.1 | downstream_gene_variant ; 3246.0bp to feature; MODIFIER | silent_mutation | Average:30.493; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg0232480149 | A -> T | LOC_Os02g53080-LOC_Os02g53090 | intergenic_region ; MODIFIER | silent_mutation | Average:30.493; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232480149 | NA | 2.16E-12 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0232480149 | NA | 1.59E-22 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.04E-45 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.18E-14 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 2.05E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 3.37E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.74E-39 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 5.37E-17 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 2.94E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 8.15E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.34E-08 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 2.61E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.23E-21 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 6.75E-09 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.39E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 3.48E-21 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 4.84E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.88E-17 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 3.01E-06 | NA | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 2.41E-22 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 3.93E-30 | mr1105_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 6.68E-07 | 5.76E-08 | mr1184_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.07E-53 | mr1194_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 3.78E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 2.89E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.55E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 4.58E-07 | 2.83E-24 | mr1276_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 7.93E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 4.04E-06 | NA | mr1284_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 6.27E-07 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.17E-21 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 5.18E-18 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 5.87E-06 | 1.16E-09 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.08E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 9.24E-06 | 2.92E-10 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 2.44E-07 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.73E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 1.75E-06 | NA | mr1494_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 5.78E-06 | 5.77E-06 | mr1499_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 8.06E-11 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 6.19E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.90E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.50E-07 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 4.26E-15 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 3.71E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 6.03E-15 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 5.81E-06 | 2.61E-17 | mr1641_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 8.10E-11 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 8.77E-06 | NA | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 2.80E-06 | mr1652_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.37E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 9.39E-06 | NA | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 4.98E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 4.73E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 5.96E-09 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 7.84E-19 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 2.75E-06 | 4.15E-11 | mr1683_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 2.35E-06 | 3.64E-07 | mr1687_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 6.09E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 2.29E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.63E-20 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 8.22E-15 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.62E-16 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 2.84E-20 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 3.85E-17 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 7.03E-13 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 5.21E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 6.55E-17 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | 9.63E-06 | 9.62E-06 | mr1876_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 4.56E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 8.30E-10 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 4.52E-07 | mr1946_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 4.52E-07 | mr1948_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 2.23E-06 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232480149 | NA | 1.77E-11 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |