\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232357463:

Variant ID: vg0232357463 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32357463
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGTCATTTTTAGCCTTATTAAAGTTTGATACTCCCTCCATTTCAGGTTATAAGACTTATAGGTTAACATCTATATAAATGTGGGCAATAGTAGAAAG[T/C]
CTTATAATATGAAATGGATAGAGTAATGTTAAATTTTGGTATATTTTAGCATTATCGAAAAAGAATAGCGTTAGATATATTTGGTGCCTTGTCAAATATT

Reverse complement sequence

AATATTTGACAAGGCACCAAATATATCTAACGCTATTCTTTTTCGATAATGCTAAAATATACCAAAATTTAACATTACTCTATCCATTTCATATTATAAG[A/G]
CTTTCTACTATTGCCCACATTTATATAGATGTTAACCTATAAGTCTTATAACCTGAAATGGAGGGAGTATCAAACTTTAATAAGGCTAAAAATGACAACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 15.30% 0.08% 0.00% NA
All Indica  2759 86.40% 13.50% 0.11% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 14.90% 85.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 69.20% 30.30% 0.43% 0.00% NA
Indica III  913 89.60% 10.40% 0.00% 0.00% NA
Indica Intermediate  786 82.60% 17.30% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232357463 T -> C LOC_Os02g52910.1 upstream_gene_variant ; 4800.0bp to feature; MODIFIER silent_mutation Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0232357463 T -> C LOC_Os02g52920.1 upstream_gene_variant ; 966.0bp to feature; MODIFIER silent_mutation Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0232357463 T -> C LOC_Os02g52900.3 downstream_gene_variant ; 4555.0bp to feature; MODIFIER silent_mutation Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0232357463 T -> C LOC_Os02g52930.1 downstream_gene_variant ; 1638.0bp to feature; MODIFIER silent_mutation Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0232357463 T -> C LOC_Os02g52900.1 downstream_gene_variant ; 4555.0bp to feature; MODIFIER silent_mutation Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0232357463 T -> C LOC_Os02g52900.2 downstream_gene_variant ; 4555.0bp to feature; MODIFIER silent_mutation Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0232357463 T -> C LOC_Os02g52920-LOC_Os02g52930 intergenic_region ; MODIFIER silent_mutation Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232357463 NA 1.96E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 2.82E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 4.52E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 7.44E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 2.83E-08 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 7.25E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 6.18E-18 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 2.83E-08 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 1.12E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 4.22E-06 mr1684 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 6.27E-07 NA mr1721 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 1.98E-08 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 4.40E-07 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 8.84E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 6.29E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 8.90E-06 8.89E-06 mr1473_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 3.13E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 7.58E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 7.60E-06 3.84E-08 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 1.22E-06 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 9.76E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 1.78E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463 NA 6.69E-07 mr1910_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251