Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232357463:

Variant ID: vg0232357463 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 32357463
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTGTCATTTTTAGCCTTATTAAAGTTTGATACTCCCTCCATTTCAGGTTATAAGACTTATAGGTTAACATCTATATAAATGTGGGCAATAGTAGAAAG[T/C]
CTTATAATATGAAATGGATAGAGTAATGTTAAATTTTGGTATATTTTAGCATTATCGAAAAAGAATAGCGTTAGATATATTTGGTGCCTTGTCAAATATT

Reverse complement sequence

AATATTTGACAAGGCACCAAATATATCTAACGCTATTCTTTTTCGATAATGCTAAAATATACCAAAATTTAACATTACTCTATCCATTTCATATTATAAG[A/G]
CTTTCTACTATTGCCCACATTTATATAGATGTTAACCTATAAGTCTTATAACCTGAAATGGAGGGAGTATCAAACTTTAATAAGGCTAAAAATGACAACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	15.30%	0.08%	0.00%	NA
All Indica	2759	86.40%	13.50%	0.11%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	14.90%	85.10%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	69.20%	30.30%	0.43%	0.00%	NA
Indica III	913	89.60%	10.40%	0.00%	0.00%	NA
Indica Intermediate	786	82.60%	17.30%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	75.60%	23.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232357463	T -> C	LOC_Os02g52910.1	upstream_gene_variant ; 4800.0bp to feature; MODIFIER	silent_mutation	Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0232357463	T -> C	LOC_Os02g52920.1	upstream_gene_variant ; 966.0bp to feature; MODIFIER	silent_mutation	Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0232357463	T -> C	LOC_Os02g52900.3	downstream_gene_variant ; 4555.0bp to feature; MODIFIER	silent_mutation	Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0232357463	T -> C	LOC_Os02g52930.1	downstream_gene_variant ; 1638.0bp to feature; MODIFIER	silent_mutation	Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0232357463	T -> C	LOC_Os02g52900.1	downstream_gene_variant ; 4555.0bp to feature; MODIFIER	silent_mutation	Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0232357463	T -> C	LOC_Os02g52900.2	downstream_gene_variant ; 4555.0bp to feature; MODIFIER	silent_mutation	Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0232357463	T -> C	LOC_Os02g52920-LOC_Os02g52930	intergenic_region ; MODIFIER	silent_mutation	Average:56.205; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232357463	NA	1.96E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	2.82E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	4.52E-14	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	7.44E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	2.83E-08	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	7.25E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	6.18E-18	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	2.83E-08	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	1.12E-09	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	4.22E-06	mr1684	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	6.27E-07	NA	mr1721	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	1.98E-08	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	4.40E-07	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	8.84E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	6.29E-06	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	8.90E-06	8.89E-06	mr1473_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	3.13E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	7.58E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	7.60E-06	3.84E-08	mr1717_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	1.22E-06	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	9.76E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	1.78E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232357463	NA	6.69E-07	mr1910_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251