Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232168585:

Variant ID: vg0232168585 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 32168585
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAAGGTGCTGTTTAGTCGTTCCGGAAGGTCTCCAGACCAGTGGATGGTGTGAATCTCACTCAGGGAGGTTAGCATGGGTAGCACCTGAATCAGGCCCCA[A/G,T]
AAAGCATATGCCAGGGGGTAGGCAAGGAAGATGTGGTCAGTGTCTTCCAGGCAGGTATTGCATAGTTGACATGTTGGGGAGGGGATGATTGACTTCTTGT

Reverse complement sequence

ACAAGAAGTCAATCATCCCCTCCCCAACATGTCAACTATGCAATACCTGCCTGGAAGACACTGACCACATCTTCCTTGCCTACCCCCTGGCATATGCTTT[T/C,A]
TGGGGCCTGATTCAGGTGCTACCCATGCTAACCTCCCTGAGTGAGATTCACACCATCCACTGGTCTGGAGACCTTCCGGAACGACTAAACAGCACCTTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	34.30%	0.06%	0.00%	T: 0.02%
All Indica	2759	98.90%	1.00%	0.07%	0.00%	T: 0.04%
All Japonica	1512	1.10%	98.90%	0.00%	0.00%	NA
Aus	269	86.60%	13.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	99.10%	0.80%	0.11%	0.00%	NA
Indica Intermediate	786	98.30%	1.50%	0.00%	0.00%	T: 0.13%
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	0.00%	100.00%	0.00%	0.00%	NA
Japonica Intermediate	241	4.60%	95.40%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	44.40%	54.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232168585	A -> G	LOC_Os02g52560.1	downstream_gene_variant ; 766.0bp to feature; MODIFIER	silent_mutation	Average:46.343; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg0232168585	A -> G	LOC_Os02g52580.1	downstream_gene_variant ; 4096.0bp to feature; MODIFIER	silent_mutation	Average:46.343; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg0232168585	A -> G	LOC_Os02g52560-LOC_Os02g52580	intergenic_region ; MODIFIER	silent_mutation	Average:46.343; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg0232168585	A -> T	LOC_Os02g52560.1	downstream_gene_variant ; 766.0bp to feature; MODIFIER	silent_mutation	Average:46.343; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg0232168585	A -> T	LOC_Os02g52580.1	downstream_gene_variant ; 4096.0bp to feature; MODIFIER	silent_mutation	Average:46.343; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg0232168585	A -> T	LOC_Os02g52560-LOC_Os02g52580	intergenic_region ; MODIFIER	silent_mutation	Average:46.343; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232168585	NA	1.70E-77	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	2.94E-44	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	9.76E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	4.90E-36	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	6.85E-32	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	3.87E-74	mr1629	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	2.46E-28	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	7.23E-35	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	7.07E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	8.13E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.11E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.22E-24	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.98E-11	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	6.04E-32	mr1102_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	2.53E-31	mr1105_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	7.86E-39	mr1152_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	9.34E-14	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	6.07E-53	mr1194_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	9.42E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	5.22E-39	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	4.78E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	9.20E-19	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.80E-33	mr1256_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	6.27E-14	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	8.06E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	2.70E-25	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	3.60E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.35E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	5.45E-51	mr1480_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.62E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	3.30E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.16E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	8.62E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	2.32E-84	mr1711_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	7.52E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	2.57E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.21E-12	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.33E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	3.66E-32	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.66E-64	mr1896_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	8.48E-22	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.77E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	1.65E-45	mr1944_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	2.66E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232168585	NA	4.44E-22	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251