\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232097918:

Variant ID: vg0232097918 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32097918
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTTTTGCCAAGTAATCACTGCACTTGAAACAAGAACCACCCTTTGGCTCATTGACTAGTTTGAAACGACCCACCGACTGCACCAAACTAAAAAGACTC[A/G]
AATATTAGGGAAGGACCTAATATCAAATAATTAGAAGGGGTGAGGCTTTGAACCCAGATCGTCTAGCCCACCACCTTGTGGAGCTAGCCGGAAGACCCCC

Reverse complement sequence

GGGGGTCTTCCGGCTAGCTCCACAAGGTGGTGGGCTAGACGATCTGGGTTCAAAGCCTCACCCCTTCTAATTATTTGATATTAGGTCCTTCCCTAATATT[T/C]
GAGTCTTTTTAGTTTGGTGCAGTCGGTGGGTCGTTTCAAACTAGTCAATGAGCCAAAGGGTGGTTCTTGTTTCAAGTGCAGTGATTACTTGGCAAAAACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 16.10% 1.16% 4.46% NA
All Indica  2759 73.40% 17.20% 1.99% 7.39% NA
All Japonica  1512 99.80% 0.10% 0.00% 0.13% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 87.60% 0.80% 2.35% 9.24% NA
Indica II  465 59.10% 32.30% 1.72% 6.88% NA
Indica III  913 80.80% 10.80% 1.31% 7.01% NA
Indica Intermediate  786 62.50% 28.10% 2.67% 6.74% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 72.20% 22.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232097918 A -> G LOC_Os02g52450.1 upstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0232097918 A -> G LOC_Os02g52450.2 upstream_gene_variant ; 3141.0bp to feature; MODIFIER silent_mutation Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0232097918 A -> G LOC_Os02g52450.3 upstream_gene_variant ; 3109.0bp to feature; MODIFIER silent_mutation Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0232097918 A -> G LOC_Os02g52470.1 downstream_gene_variant ; 1168.0bp to feature; MODIFIER silent_mutation Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0232097918 A -> G LOC_Os02g52470.2 downstream_gene_variant ; 1168.0bp to feature; MODIFIER silent_mutation Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0232097918 A -> G LOC_Os02g52460.1 intron_variant ; MODIFIER silent_mutation Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0232097918 A -> DEL N N silent_mutation Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232097918 NA 2.52E-08 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232097918 NA 3.12E-08 mr1523 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232097918 NA 6.08E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232097918 NA 9.17E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232097918 NA 3.15E-07 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232097918 NA 6.15E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251