\
| Variant ID: vg0232097918 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32097918 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGTTTTTGCCAAGTAATCACTGCACTTGAAACAAGAACCACCCTTTGGCTCATTGACTAGTTTGAAACGACCCACCGACTGCACCAAACTAAAAAGACTC[A/G]
AATATTAGGGAAGGACCTAATATCAAATAATTAGAAGGGGTGAGGCTTTGAACCCAGATCGTCTAGCCCACCACCTTGTGGAGCTAGCCGGAAGACCCCC
GGGGGTCTTCCGGCTAGCTCCACAAGGTGGTGGGCTAGACGATCTGGGTTCAAAGCCTCACCCCTTCTAATTATTTGATATTAGGTCCTTCCCTAATATT[T/C]
GAGTCTTTTTAGTTTGGTGCAGTCGGTGGGTCGTTTCAAACTAGTCAATGAGCCAAAGGGTGGTTCTTGTTTCAAGTGCAGTGATTACTTGGCAAAAACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 16.10% | 1.16% | 4.46% | NA |
| All Indica | 2759 | 73.40% | 17.20% | 1.99% | 7.39% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.00% | 0.13% | NA |
| Aus | 269 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.60% | 0.80% | 2.35% | 9.24% | NA |
| Indica II | 465 | 59.10% | 32.30% | 1.72% | 6.88% | NA |
| Indica III | 913 | 80.80% | 10.80% | 1.31% | 7.01% | NA |
| Indica Intermediate | 786 | 62.50% | 28.10% | 2.67% | 6.74% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 22.20% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232097918 | A -> G | LOC_Os02g52450.1 | upstream_gene_variant ; 3256.0bp to feature; MODIFIER | silent_mutation | Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0232097918 | A -> G | LOC_Os02g52450.2 | upstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0232097918 | A -> G | LOC_Os02g52450.3 | upstream_gene_variant ; 3109.0bp to feature; MODIFIER | silent_mutation | Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0232097918 | A -> G | LOC_Os02g52470.1 | downstream_gene_variant ; 1168.0bp to feature; MODIFIER | silent_mutation | Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0232097918 | A -> G | LOC_Os02g52470.2 | downstream_gene_variant ; 1168.0bp to feature; MODIFIER | silent_mutation | Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0232097918 | A -> G | LOC_Os02g52460.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0232097918 | A -> DEL | N | N | silent_mutation | Average:60.563; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232097918 | NA | 2.52E-08 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232097918 | NA | 3.12E-08 | mr1523 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232097918 | NA | 6.08E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232097918 | NA | 9.17E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232097918 | NA | 3.15E-07 | mr1722_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232097918 | NA | 6.15E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |