Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232097918:

Variant ID: vg0232097918 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 32097918
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTTTTGCCAAGTAATCACTGCACTTGAAACAAGAACCACCCTTTGGCTCATTGACTAGTTTGAAACGACCCACCGACTGCACCAAACTAAAAAGACTC[A/G]
AATATTAGGGAAGGACCTAATATCAAATAATTAGAAGGGGTGAGGCTTTGAACCCAGATCGTCTAGCCCACCACCTTGTGGAGCTAGCCGGAAGACCCCC

Reverse complement sequence

GGGGGTCTTCCGGCTAGCTCCACAAGGTGGTGGGCTAGACGATCTGGGTTCAAAGCCTCACCCCTTCTAATTATTTGATATTAGGTCCTTCCCTAATATT[T/C]
GAGTCTTTTTAGTTTGGTGCAGTCGGTGGGTCGTTTCAAACTAGTCAATGAGCCAAAGGGTGGTTCTTGTTTCAAGTGCAGTGATTACTTGGCAAAAACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	16.10%	1.16%	4.46%	NA
All Indica	2759	73.40%	17.20%	1.99%	7.39%	NA
All Japonica	1512	99.80%	0.10%	0.00%	0.13%	NA
Aus	269	5.60%	94.40%	0.00%	0.00%	NA
Indica I	595	87.60%	0.80%	2.35%	9.24%	NA
Indica II	465	59.10%	32.30%	1.72%	6.88%	NA
Indica III	913	80.80%	10.80%	1.31%	7.01%	NA
Indica Intermediate	786	62.50%	28.10%	2.67%	6.74%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	72.20%	22.20%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232097918	A -> G	LOC_Os02g52450.1	upstream_gene_variant ; 3256.0bp to feature; MODIFIER	silent_mutation	Average:60.563; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0232097918	A -> G	LOC_Os02g52450.2	upstream_gene_variant ; 3141.0bp to feature; MODIFIER	silent_mutation	Average:60.563; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0232097918	A -> G	LOC_Os02g52450.3	upstream_gene_variant ; 3109.0bp to feature; MODIFIER	silent_mutation	Average:60.563; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0232097918	A -> G	LOC_Os02g52470.1	downstream_gene_variant ; 1168.0bp to feature; MODIFIER	silent_mutation	Average:60.563; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0232097918	A -> G	LOC_Os02g52470.2	downstream_gene_variant ; 1168.0bp to feature; MODIFIER	silent_mutation	Average:60.563; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0232097918	A -> G	LOC_Os02g52460.1	intron_variant ; MODIFIER	silent_mutation	Average:60.563; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0232097918	A -> DEL	N	N	silent_mutation	Average:60.563; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232097918	NA	2.52E-08	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232097918	NA	3.12E-08	mr1523	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232097918	NA	6.08E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232097918	NA	9.17E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232097918	NA	3.15E-07	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232097918	NA	6.15E-07	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251