| Variant ID: vg0232096479 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32096479 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.14, others allele: 0.00, population size: 28. )
AAGAGTGAAAAATCAATACGATGGAACTGAAATCCTCTTTTGTTTTTAATTTAGTTAGCAATGGGTATTTGTGGAGTTCTTGTGAAGTAAGAGAATACTG[T/A]
CAGAAACTCTGCATTTTATTCCCCATGGAAACTATACTACAGCCTATTTGTGGAGGTGGATTTTCATCCCTCGAGGGGATATCCCCTCGTTTCATGCATG
CATGCATGAAACGAGGGGATATCCCCTCGAGGGATGAAAATCCACCTCCACAAATAGGCTGTAGTATAGTTTCCATGGGGAATAAAATGCAGAGTTTCTG[A/T]
CAGTATTCTCTTACTTCACAAGAACTCCACAAATACCCATTGCTAACTAAATTAAAAACAAAAGAGGATTTCAGTTCCATCGTATTGATTTTTCACTCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 47.90% | 0.11% | 0.44% | NA |
| All Indica | 2759 | 18.20% | 80.90% | 0.18% | 0.69% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 1.20% | 98.30% | 0.17% | 0.34% | NA |
| Indica II | 465 | 34.20% | 64.70% | 0.22% | 0.86% | NA |
| Indica III | 913 | 11.70% | 87.60% | 0.11% | 0.55% | NA |
| Indica Intermediate | 786 | 29.10% | 69.60% | 0.25% | 1.02% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 21.10% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232096479 | T -> A | LOC_Os02g52450.1 | upstream_gene_variant ; 1817.0bp to feature; MODIFIER | silent_mutation | Average:30.175; most accessible tissue: Callus, score: 53.935 | N | N | N | N |
| vg0232096479 | T -> A | LOC_Os02g52450.2 | upstream_gene_variant ; 1702.0bp to feature; MODIFIER | silent_mutation | Average:30.175; most accessible tissue: Callus, score: 53.935 | N | N | N | N |
| vg0232096479 | T -> A | LOC_Os02g52450.3 | upstream_gene_variant ; 1670.0bp to feature; MODIFIER | silent_mutation | Average:30.175; most accessible tissue: Callus, score: 53.935 | N | N | N | N |
| vg0232096479 | T -> A | LOC_Os02g52440.1 | downstream_gene_variant ; 4524.0bp to feature; MODIFIER | silent_mutation | Average:30.175; most accessible tissue: Callus, score: 53.935 | N | N | N | N |
| vg0232096479 | T -> A | LOC_Os02g52470.1 | downstream_gene_variant ; 2607.0bp to feature; MODIFIER | silent_mutation | Average:30.175; most accessible tissue: Callus, score: 53.935 | N | N | N | N |
| vg0232096479 | T -> A | LOC_Os02g52470.2 | downstream_gene_variant ; 2607.0bp to feature; MODIFIER | silent_mutation | Average:30.175; most accessible tissue: Callus, score: 53.935 | N | N | N | N |
| vg0232096479 | T -> A | LOC_Os02g52460.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.175; most accessible tissue: Callus, score: 53.935 | N | N | N | N |
| vg0232096479 | T -> DEL | N | N | silent_mutation | Average:30.175; most accessible tissue: Callus, score: 53.935 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232096479 | NA | 2.57E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232096479 | NA | 2.13E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232096479 | NA | 2.46E-20 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232096479 | NA | 3.56E-14 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232096479 | NA | 3.02E-11 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232096479 | NA | 1.35E-09 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232096479 | NA | 1.72E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232096479 | NA | 2.10E-09 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232096479 | NA | 1.50E-13 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232096479 | NA | 8.82E-06 | mr1982 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/