\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232096479:

Variant ID: vg0232096479 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32096479
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.14, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAGTGAAAAATCAATACGATGGAACTGAAATCCTCTTTTGTTTTTAATTTAGTTAGCAATGGGTATTTGTGGAGTTCTTGTGAAGTAAGAGAATACTG[T/A]
CAGAAACTCTGCATTTTATTCCCCATGGAAACTATACTACAGCCTATTTGTGGAGGTGGATTTTCATCCCTCGAGGGGATATCCCCTCGTTTCATGCATG

Reverse complement sequence

CATGCATGAAACGAGGGGATATCCCCTCGAGGGATGAAAATCCACCTCCACAAATAGGCTGTAGTATAGTTTCCATGGGGAATAAAATGCAGAGTTTCTG[A/T]
CAGTATTCTCTTACTTCACAAGAACTCCACAAATACCCATTGCTAACTAAATTAAAAACAAAAGAGGATTTCAGTTCCATCGTATTGATTTTTCACTCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 47.90% 0.11% 0.44% NA
All Indica  2759 18.20% 80.90% 0.18% 0.69% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 1.20% 98.30% 0.17% 0.34% NA
Indica II  465 34.20% 64.70% 0.22% 0.86% NA
Indica III  913 11.70% 87.60% 0.11% 0.55% NA
Indica Intermediate  786 29.10% 69.60% 0.25% 1.02% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232096479 T -> A LOC_Os02g52450.1 upstream_gene_variant ; 1817.0bp to feature; MODIFIER silent_mutation Average:30.175; most accessible tissue: Callus, score: 53.935 N N N N
vg0232096479 T -> A LOC_Os02g52450.2 upstream_gene_variant ; 1702.0bp to feature; MODIFIER silent_mutation Average:30.175; most accessible tissue: Callus, score: 53.935 N N N N
vg0232096479 T -> A LOC_Os02g52450.3 upstream_gene_variant ; 1670.0bp to feature; MODIFIER silent_mutation Average:30.175; most accessible tissue: Callus, score: 53.935 N N N N
vg0232096479 T -> A LOC_Os02g52440.1 downstream_gene_variant ; 4524.0bp to feature; MODIFIER silent_mutation Average:30.175; most accessible tissue: Callus, score: 53.935 N N N N
vg0232096479 T -> A LOC_Os02g52470.1 downstream_gene_variant ; 2607.0bp to feature; MODIFIER silent_mutation Average:30.175; most accessible tissue: Callus, score: 53.935 N N N N
vg0232096479 T -> A LOC_Os02g52470.2 downstream_gene_variant ; 2607.0bp to feature; MODIFIER silent_mutation Average:30.175; most accessible tissue: Callus, score: 53.935 N N N N
vg0232096479 T -> A LOC_Os02g52460.1 intron_variant ; MODIFIER silent_mutation Average:30.175; most accessible tissue: Callus, score: 53.935 N N N N
vg0232096479 T -> DEL N N silent_mutation Average:30.175; most accessible tissue: Callus, score: 53.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232096479 NA 2.57E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 2.13E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 2.46E-20 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 3.56E-14 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 3.02E-11 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 1.35E-09 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 1.72E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 2.10E-09 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 1.50E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 8.82E-06 mr1982 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 7.81E-06 mr1057_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 1.25E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 3.74E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 2.42E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 4.88E-21 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 3.91E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 1.20E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 7.05E-07 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 4.69E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 7.01E-07 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 1.44E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 3.93E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 1.15E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 1.63E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 3.45E-10 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 6.70E-15 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 8.07E-11 mr1904_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232096479 NA 5.30E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251