Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232092446:

Variant ID: vg0232092446 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 32092446
Reference Allele: GA	Alternative Allele: AA,G
Primary Allele: GA	Secondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAAAGGAGACTTAGGGTGTGTTTAGCTCACGAAAAGAAAATTTTAGGGTGTCACGTCGGATGTTTGACCGGATGTCGGAAGGGGTTTCCGGACACGAAT[GA/AA,G]
AAAAACTAATTTCATAACTCTCCTAGAAACCGCTAGACAAATCTTTTAAGCCTAATTAAGCCGGCATTAGCACATATGGGGTTACTGTAGCACTTATGAC

Reverse complement sequence

GTCATAAGTGCTACAGTAACCCCATATGTGCTAATGCCGGCTTAATTAGGCTTAAAAGATTTGTCTAGCGGTTTCTAGGAGAGTTATGAAATTAGTTTTT[TC/TT,C]
ATTCGTGTCCGGAAACCCCTTCCGACATCCGGTCAAACATCCGACGTGACACCCTAAAATTTTCTTTTCGTGAGCTAAACACACCCTAAGTCTCCTTTAG

Allele Frequencies:

Populations	Population Size	Frequency of GA(primary allele)	Frequency of AA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.00%	47.80%	0.15%	0.00%	G: 0.02%
All Indica	2759	19.00%	80.80%	0.22%	0.00%	NA
All Japonica	1512	99.50%	0.40%	0.07%	0.00%	G: 0.07%
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	2.00%	98.00%	0.00%	0.00%	NA
Indica II	465	35.30%	64.50%	0.22%	0.00%	NA
Indica III	913	12.40%	87.50%	0.11%	0.00%	NA
Indica Intermediate	786	30.00%	69.50%	0.51%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.00%	G: 0.20%
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232092446	GA -> G	LOC_Os02g52430.2	upstream_gene_variant ; 2143.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> G	LOC_Os02g52430.1	upstream_gene_variant ; 2283.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> G	LOC_Os02g52440.1	downstream_gene_variant ; 492.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> G	LOC_Os02g52450.1	downstream_gene_variant ; 201.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> G	LOC_Os02g52460.1	downstream_gene_variant ; 2875.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> G	LOC_Os02g52450.2	downstream_gene_variant ; 201.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> G	LOC_Os02g52450.3	downstream_gene_variant ; 201.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> G	LOC_Os02g52440-LOC_Os02g52450	intergenic_region ; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> AA	LOC_Os02g52430.2	upstream_gene_variant ; 2142.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> AA	LOC_Os02g52430.1	upstream_gene_variant ; 2282.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> AA	LOC_Os02g52440.1	downstream_gene_variant ; 491.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> AA	LOC_Os02g52450.1	downstream_gene_variant ; 202.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> AA	LOC_Os02g52460.1	downstream_gene_variant ; 2876.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> AA	LOC_Os02g52450.2	downstream_gene_variant ; 202.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> AA	LOC_Os02g52450.3	downstream_gene_variant ; 202.0bp to feature; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0232092446	GA -> AA	LOC_Os02g52440-LOC_Os02g52450	intergenic_region ; MODIFIER	silent_mutation	Average:41.953; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232092446	NA	3.78E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	2.06E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	1.37E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	6.10E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	4.32E-19	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	5.77E-14	mr1655	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	1.73E-11	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	4.99E-06	2.27E-11	mr1717	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	3.65E-06	3.65E-06	mr1717	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	3.91E-10	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	2.28E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	1.63E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	3.23E-09	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	1.83E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	8.70E-07	mr1982	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	6.30E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	5.87E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	1.76E-20	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	2.85E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	1.34E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	1.73E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	3.15E-07	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	4.01E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	9.22E-06	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	2.37E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	8.56E-13	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	9.15E-08	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	2.29E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	4.61E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446	NA	4.61E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251