\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232092446:

Variant ID: vg0232092446 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 32092446
Reference Allele: GAAlternative Allele: AA,G
Primary Allele: GASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAAAGGAGACTTAGGGTGTGTTTAGCTCACGAAAAGAAAATTTTAGGGTGTCACGTCGGATGTTTGACCGGATGTCGGAAGGGGTTTCCGGACACGAAT[GA/AA,G]
AAAAACTAATTTCATAACTCTCCTAGAAACCGCTAGACAAATCTTTTAAGCCTAATTAAGCCGGCATTAGCACATATGGGGTTACTGTAGCACTTATGAC

Reverse complement sequence

GTCATAAGTGCTACAGTAACCCCATATGTGCTAATGCCGGCTTAATTAGGCTTAAAAGATTTGTCTAGCGGTTTCTAGGAGAGTTATGAAATTAGTTTTT[TC/TT,C]
ATTCGTGTCCGGAAACCCCTTCCGACATCCGGTCAAACATCCGACGTGACACCCTAAAATTTTCTTTTCGTGAGCTAAACACACCCTAAGTCTCCTTTAG

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.00% 47.80% 0.15% 0.00% G: 0.02%
All Indica  2759 19.00% 80.80% 0.22% 0.00% NA
All Japonica  1512 99.50% 0.40% 0.07% 0.00% G: 0.07%
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 2.00% 98.00% 0.00% 0.00% NA
Indica II  465 35.30% 64.50% 0.22% 0.00% NA
Indica III  913 12.40% 87.50% 0.11% 0.00% NA
Indica Intermediate  786 30.00% 69.50% 0.51% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.00% G: 0.20%
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232092446 GA -> G LOC_Os02g52430.2 upstream_gene_variant ; 2143.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> G LOC_Os02g52430.1 upstream_gene_variant ; 2283.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> G LOC_Os02g52440.1 downstream_gene_variant ; 492.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> G LOC_Os02g52450.1 downstream_gene_variant ; 201.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> G LOC_Os02g52460.1 downstream_gene_variant ; 2875.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> G LOC_Os02g52450.2 downstream_gene_variant ; 201.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> G LOC_Os02g52450.3 downstream_gene_variant ; 201.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> G LOC_Os02g52440-LOC_Os02g52450 intergenic_region ; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> AA LOC_Os02g52430.2 upstream_gene_variant ; 2142.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> AA LOC_Os02g52430.1 upstream_gene_variant ; 2282.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> AA LOC_Os02g52440.1 downstream_gene_variant ; 491.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> AA LOC_Os02g52450.1 downstream_gene_variant ; 202.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> AA LOC_Os02g52460.1 downstream_gene_variant ; 2876.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> AA LOC_Os02g52450.2 downstream_gene_variant ; 202.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> AA LOC_Os02g52450.3 downstream_gene_variant ; 202.0bp to feature; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N
vg0232092446 GA -> AA LOC_Os02g52440-LOC_Os02g52450 intergenic_region ; MODIFIER silent_mutation Average:41.953; most accessible tissue: Minghui63 root, score: 71.702 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232092446 NA 3.78E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 2.06E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 1.37E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 6.10E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 4.32E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 5.77E-14 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 1.73E-11 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 4.99E-06 2.27E-11 mr1717 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 3.65E-06 3.65E-06 mr1717 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 3.91E-10 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 2.28E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 1.63E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 3.23E-09 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 1.83E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 8.70E-07 mr1982 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 6.30E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 5.87E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 1.76E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 2.85E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 1.34E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 1.73E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 3.15E-07 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 4.01E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 9.22E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 2.37E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 8.56E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 9.15E-08 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 2.29E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 4.61E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232092446 NA 4.61E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251