\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232090414:

Variant ID: vg0232090414 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32090414
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGCGCAATACCATCTATTAATGATCCTCCCGGGGGGGGGGGGGGGGGGCGGTGATCGGCTGATCGCCATCCAGAAAGACGATTAATTAATCTTTTTAA[A/G]
CACATGAACATGATTAATTGATATCGCAGTAGTAGACAATTGATCGGCATCACGACGGGACCCACTCATCAACGTCACGGTGGAACAAAGGATGGAAAAC

Reverse complement sequence

GTTTTCCATCCTTTGTTCCACCGTGACGTTGATGAGTGGGTCCCGTCGTGATGCCGATCAATTGTCTACTACTGCGATATCAATTAATCATGTTCATGTG[T/C]
TTAAAAAGATTAATTAATCGTCTTTCTGGATGGCGATCAGCCGATCACCGCCCCCCCCCCCCCCCCCCGGGAGGATCATTAATAGATGGTATTGCGCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 37.90% 1.59% 2.52% NA
All Indica  2759 88.00% 5.30% 2.57% 4.17% NA
All Japonica  1512 0.40% 99.50% 0.07% 0.00% NA
Aus  269 95.90% 3.30% 0.00% 0.74% NA
Indica I  595 90.90% 0.80% 5.21% 3.03% NA
Indica II  465 91.80% 4.50% 2.37% 1.29% NA
Indica III  913 88.60% 2.70% 1.10% 7.56% NA
Indica Intermediate  786 82.70% 12.10% 2.42% 2.80% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.80% 0.41% 0.00% NA
VI/Aromatic  96 12.50% 86.50% 0.00% 1.04% NA
Intermediate  90 41.10% 54.40% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232090414 A -> G LOC_Os02g52420.1 upstream_gene_variant ; 4845.0bp to feature; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> G LOC_Os02g52430.2 upstream_gene_variant ; 110.0bp to feature; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> G LOC_Os02g52440.1 upstream_gene_variant ; 1101.0bp to feature; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> G LOC_Os02g52420.3 upstream_gene_variant ; 4845.0bp to feature; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> G LOC_Os02g52420.2 upstream_gene_variant ; 4845.0bp to feature; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> G LOC_Os02g52430.1 upstream_gene_variant ; 250.0bp to feature; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> G LOC_Os02g52450.1 downstream_gene_variant ; 2234.0bp to feature; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> G LOC_Os02g52460.1 downstream_gene_variant ; 4908.0bp to feature; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> G LOC_Os02g52450.2 downstream_gene_variant ; 2234.0bp to feature; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> G LOC_Os02g52450.3 downstream_gene_variant ; 2234.0bp to feature; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> G LOC_Os02g52430-LOC_Os02g52440 intergenic_region ; MODIFIER silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N
vg0232090414 A -> DEL N N silent_mutation Average:94.151; most accessible tissue: Zhenshan97 flag leaf, score: 98.085 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0232090414 A G -0.02 -0.02 -0.03 -0.03 0.02 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232090414 NA 2.21E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 1.72E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 7.81E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 1.54E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 1.26E-54 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 4.88E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 2.04E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 3.51E-06 mr1982 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 6.21E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 1.51E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 1.74E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 3.10E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 6.64E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 1.20E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 5.49E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 1.28E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 2.76E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 2.99E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232090414 NA 1.27E-07 mr1980_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251