\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232077620:

Variant ID: vg0232077620 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32077620
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


CGACCTTGAGGCGACCTAACGCCTCCTCGATCGACATCGTGGAGAGGTCCAGCTGAGACTCGATCGAGCGAGCGATCTGCCTGTACTTCTCTGGAACGCA[G/A]
CGGAAGAGCTTCTCGACAGCTCTCTCCTCGTCGTAGGTGTCGTCGCTGTACTGCACCATCTTCTACAAGAGAGTGTTGAGACGGAGGGCAAAGTCATCCT

Reverse complement sequence

AGGATGACTTTGCCCTCCGTCTCAACACTCTCTTGTAGAAGATGGTGCAGTACAGCGACGACACCTACGACGAGGAGAGAGCTGTCGAGAAGCTCTTCCG[C/T]
TGCGTTCCAGAGAAGTACAGGCAGATCGCTCGCTCGATCGAGTCTCAGCTGGACCTCTCCACGATGTCGATCGAGGAGGCGTTAGGTCGCCTCAAGGTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 5.00% 0.89% 0.00% NA
All Indica  2759 90.70% 8.30% 1.01% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 93.70% 1.90% 4.46% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 72.00% 25.20% 2.80% 0.00% NA
Indica III  913 95.60% 3.50% 0.88% 0.00% NA
Indica Intermediate  786 88.90% 10.20% 0.89% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232077620 G -> A LOC_Os02g52420.1 downstream_gene_variant ; 3671.0bp to feature; MODIFIER silent_mutation Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 N N N N
vg0232077620 G -> A LOC_Os02g52420.3 downstream_gene_variant ; 3662.0bp to feature; MODIFIER silent_mutation Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 N N N N
vg0232077620 G -> A LOC_Os02g52420.2 downstream_gene_variant ; 3671.0bp to feature; MODIFIER silent_mutation Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 N N N N
vg0232077620 G -> A LOC_Os02g52410.1 intron_variant ; MODIFIER silent_mutation Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232077620 NA 9.07E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620 NA 2.89E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620 NA 2.03E-06 mr1712_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620 NA 6.13E-07 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620 2.01E-07 3.78E-09 mr1910_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620 5.53E-07 1.32E-08 mr1946_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620 5.53E-07 1.32E-08 mr1948_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251