Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232077620:

Variant ID: vg0232077620 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 32077620
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

CGACCTTGAGGCGACCTAACGCCTCCTCGATCGACATCGTGGAGAGGTCCAGCTGAGACTCGATCGAGCGAGCGATCTGCCTGTACTTCTCTGGAACGCA[G/A]
CGGAAGAGCTTCTCGACAGCTCTCTCCTCGTCGTAGGTGTCGTCGCTGTACTGCACCATCTTCTACAAGAGAGTGTTGAGACGGAGGGCAAAGTCATCCT

Reverse complement sequence

AGGATGACTTTGCCCTCCGTCTCAACACTCTCTTGTAGAAGATGGTGCAGTACAGCGACGACACCTACGACGAGGAGAGAGCTGTCGAGAAGCTCTTCCG[C/T]
TGCGTTCCAGAGAAGTACAGGCAGATCGCTCGCTCGATCGAGTCTCAGCTGGACCTCTCCACGATGTCGATCGAGGAGGCGTTAGGTCGCCTCAAGGTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	5.00%	0.89%	0.00%	NA
All Indica	2759	90.70%	8.30%	1.01%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	93.70%	1.90%	4.46%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	72.00%	25.20%	2.80%	0.00%	NA
Indica III	913	95.60%	3.50%	0.88%	0.00%	NA
Indica Intermediate	786	88.90%	10.20%	0.89%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	2.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232077620	G -> A	LOC_Os02g52420.1	downstream_gene_variant ; 3671.0bp to feature; MODIFIER	silent_mutation	Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351	N	N	N	N
vg0232077620	G -> A	LOC_Os02g52420.3	downstream_gene_variant ; 3662.0bp to feature; MODIFIER	silent_mutation	Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351	N	N	N	N
vg0232077620	G -> A	LOC_Os02g52420.2	downstream_gene_variant ; 3671.0bp to feature; MODIFIER	silent_mutation	Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351	N	N	N	N
vg0232077620	G -> A	LOC_Os02g52410.1	intron_variant ; MODIFIER	silent_mutation	Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232077620	NA	9.07E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620	NA	2.89E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620	NA	2.03E-06	mr1712_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620	NA	6.13E-07	mr1717_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620	2.01E-07	3.78E-09	mr1910_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620	5.53E-07	1.32E-08	mr1946_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232077620	5.53E-07	1.32E-08	mr1948_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251