\
| Variant ID: vg0232077620 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32077620 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 127. )
CGACCTTGAGGCGACCTAACGCCTCCTCGATCGACATCGTGGAGAGGTCCAGCTGAGACTCGATCGAGCGAGCGATCTGCCTGTACTTCTCTGGAACGCA[G/A]
CGGAAGAGCTTCTCGACAGCTCTCTCCTCGTCGTAGGTGTCGTCGCTGTACTGCACCATCTTCTACAAGAGAGTGTTGAGACGGAGGGCAAAGTCATCCT
AGGATGACTTTGCCCTCCGTCTCAACACTCTCTTGTAGAAGATGGTGCAGTACAGCGACGACACCTACGACGAGGAGAGAGCTGTCGAGAAGCTCTTCCG[C/T]
TGCGTTCCAGAGAAGTACAGGCAGATCGCTCGCTCGATCGAGTCTCAGCTGGACCTCTCCACGATGTCGATCGAGGAGGCGTTAGGTCGCCTCAAGGTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 5.00% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 90.70% | 8.30% | 1.01% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 93.70% | 1.90% | 4.46% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 72.00% | 25.20% | 2.80% | 0.00% | NA |
| Indica III | 913 | 95.60% | 3.50% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 88.90% | 10.20% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232077620 | G -> A | LOC_Os02g52420.1 | downstream_gene_variant ; 3671.0bp to feature; MODIFIER | silent_mutation | Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 | N | N | N | N |
| vg0232077620 | G -> A | LOC_Os02g52420.3 | downstream_gene_variant ; 3662.0bp to feature; MODIFIER | silent_mutation | Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 | N | N | N | N |
| vg0232077620 | G -> A | LOC_Os02g52420.2 | downstream_gene_variant ; 3671.0bp to feature; MODIFIER | silent_mutation | Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 | N | N | N | N |
| vg0232077620 | G -> A | LOC_Os02g52410.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.437; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232077620 | NA | 9.07E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232077620 | NA | 2.89E-06 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232077620 | NA | 2.03E-06 | mr1712_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232077620 | NA | 6.13E-07 | mr1717_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232077620 | 2.01E-07 | 3.78E-09 | mr1910_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232077620 | 5.53E-07 | 1.32E-08 | mr1946_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232077620 | 5.53E-07 | 1.32E-08 | mr1948_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |