\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232073631:

Variant ID: vg0232073631 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32073631
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


AATTCAAAATTTGAATGGGATGCTATCCTAGAGGGCATCCAAACTGAATAAAGCATAAAGGAGGCATAAAGGAGATGCTAATTGTTGCTGTCCTACTAAC[C/T,A]
GCAGCTGTCCTAGCAACTGAAAATATGCTAAAGGAGTAGATGCTGTCCTGAAAAAGGTGAAACTACCCAAAAGCAAAAAGAAGAAATCAGGACCAAGGAC

Reverse complement sequence

GTCCTTGGTCCTGATTTCTTCTTTTTGCTTTTGGGTAGTTTCACCTTTTTCAGGACAGCATCTACTCCTTTAGCATATTTTCAGTTGCTAGGACAGCTGC[G/A,T]
GTTAGTAGGACAGCAACAATTAGCATCTCCTTTATGCCTCCTTTATGCTTTATTCAGTTTGGATGCCCTCTAGGATAGCATCCCATTCAAATTTTGAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 48.20% 0.61% 0.30% A: 0.02%
All Indica  2759 81.30% 18.10% 0.14% 0.47% A: 0.04%
All Japonica  1512 8.70% 89.90% 1.46% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 98.50% 1.20% 0.17% 0.17% NA
Indica II  465 64.90% 34.20% 0.22% 0.43% A: 0.22%
Indica III  913 88.00% 11.60% 0.00% 0.44% NA
Indica Intermediate  786 70.20% 28.80% 0.25% 0.76% NA
Temperate Japonica  767 3.00% 96.30% 0.65% 0.00% NA
Tropical Japonica  504 4.40% 95.00% 0.60% 0.00% NA
Japonica Intermediate  241 35.70% 58.50% 5.81% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 28.90% 66.70% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232073631 C -> A LOC_Os02g52390.1 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:47.76; most accessible tissue: Minghui63 flower, score: 65.501 N N N N
vg0232073631 C -> A LOC_Os02g52410.1 intron_variant ; MODIFIER silent_mutation Average:47.76; most accessible tissue: Minghui63 flower, score: 65.501 N N N N
vg0232073631 C -> T LOC_Os02g52390.1 downstream_gene_variant ; 3175.0bp to feature; MODIFIER silent_mutation Average:47.76; most accessible tissue: Minghui63 flower, score: 65.501 N N N N
vg0232073631 C -> T LOC_Os02g52410.1 intron_variant ; MODIFIER silent_mutation Average:47.76; most accessible tissue: Minghui63 flower, score: 65.501 N N N N
vg0232073631 C -> DEL N N silent_mutation Average:47.76; most accessible tissue: Minghui63 flower, score: 65.501 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232073631 NA 2.66E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0232073631 NA 1.31E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 5.19E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 3.51E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 1.58E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 5.41E-14 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 1.01E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 1.17E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 3.47E-10 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 1.82E-11 mr1770 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 8.37E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 2.96E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 1.73E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 3.74E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 8.09E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 3.64E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 7.66E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 9.60E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 1.10E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 9.72E-09 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 6.65E-07 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 9.45E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 2.60E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 2.57E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 1.60E-07 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 4.37E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 1.19E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 4.33E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 4.62E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 1.37E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 1.85E-09 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631 NA 5.31E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251