Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0232073631:

Variant ID: vg0232073631 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 32073631
Reference Allele: C	Alternative Allele: T,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

AATTCAAAATTTGAATGGGATGCTATCCTAGAGGGCATCCAAACTGAATAAAGCATAAAGGAGGCATAAAGGAGATGCTAATTGTTGCTGTCCTACTAAC[C/T,A]
GCAGCTGTCCTAGCAACTGAAAATATGCTAAAGGAGTAGATGCTGTCCTGAAAAAGGTGAAACTACCCAAAAGCAAAAAGAAGAAATCAGGACCAAGGAC

Reverse complement sequence

GTCCTTGGTCCTGATTTCTTCTTTTTGCTTTTGGGTAGTTTCACCTTTTTCAGGACAGCATCTACTCCTTTAGCATATTTTCAGTTGCTAGGACAGCTGC[G/A,T]
GTTAGTAGGACAGCAACAATTAGCATCTCCTTTATGCCTCCTTTATGCTTTATTCAGTTTGGATGCCCTCTAGGATAGCATCCCATTCAAATTTTGAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.90%	48.20%	0.61%	0.30%	A: 0.02%
All Indica	2759	81.30%	18.10%	0.14%	0.47%	A: 0.04%
All Japonica	1512	8.70%	89.90%	1.46%	0.00%	NA
Aus	269	1.90%	98.10%	0.00%	0.00%	NA
Indica I	595	98.50%	1.20%	0.17%	0.17%	NA
Indica II	465	64.90%	34.20%	0.22%	0.43%	A: 0.22%
Indica III	913	88.00%	11.60%	0.00%	0.44%	NA
Indica Intermediate	786	70.20%	28.80%	0.25%	0.76%	NA
Temperate Japonica	767	3.00%	96.30%	0.65%	0.00%	NA
Tropical Japonica	504	4.40%	95.00%	0.60%	0.00%	NA
Japonica Intermediate	241	35.70%	58.50%	5.81%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	28.90%	66.70%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232073631	C -> A	LOC_Os02g52390.1	downstream_gene_variant ; 3175.0bp to feature; MODIFIER	silent_mutation	Average:47.76; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N
vg0232073631	C -> A	LOC_Os02g52410.1	intron_variant ; MODIFIER	silent_mutation	Average:47.76; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N
vg0232073631	C -> T	LOC_Os02g52390.1	downstream_gene_variant ; 3175.0bp to feature; MODIFIER	silent_mutation	Average:47.76; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N
vg0232073631	C -> T	LOC_Os02g52410.1	intron_variant ; MODIFIER	silent_mutation	Average:47.76; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N
vg0232073631	C -> DEL	N	N	silent_mutation	Average:47.76; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232073631	NA	2.66E-07	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0232073631	NA	1.31E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	5.19E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	3.51E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	1.58E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	5.41E-14	mr1655	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	1.01E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	1.17E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	3.47E-10	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	1.82E-11	mr1770	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	8.37E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	2.96E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	1.73E-07	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	3.74E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	8.09E-07	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	3.64E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	7.66E-07	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	9.60E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	1.10E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	9.72E-09	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	6.65E-07	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	9.45E-19	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	2.60E-07	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	2.57E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	1.60E-07	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	4.37E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	1.19E-06	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	4.33E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	4.62E-06	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	1.37E-13	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	1.85E-09	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232073631	NA	5.31E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251