\
| Variant ID: vg0232030438 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32030438 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 90. )
CAGTCTTCATTCGCCAAAGACCGCACCACACCCACCGGCAGCTCCTCCTCACACCTAGGTCGCCTCCTCCACCGCCGGCCGCGCCACTCTGCGCCAAGCC[G/A]
GCCTCCTCCACCGGACGCGCCTCGCGCTAATCCGGTCTCCCTCCATCGGTCGCGCCTCCCGCGCCAAGCCGGCCTCTATCTCTGCCGCTCGCGCCTCTCG
CGAGAGGCGCGAGCGGCAGAGATAGAGGCCGGCTTGGCGCGGGAGGCGCGACCGATGGAGGGAGACCGGATTAGCGCGAGGCGCGTCCGGTGGAGGAGGC[C/T]
GGCTTGGCGCAGAGTGGCGCGGCCGGCGGTGGAGGAGGCGACCTAGGTGTGAGGAGGAGCTGCCGGTGGGTGTGGTGCGGTCTTTGGCGAATGAAGACTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 2.60% | 5.31% | 0.00% | NA |
| All Indica | 2759 | 90.60% | 3.90% | 5.51% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 63.20% | 4.80% | 31.97% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.10% | 8.80% | 13.12% | 0.00% | NA |
| Indica III | 913 | 92.10% | 3.50% | 4.38% | 0.00% | NA |
| Indica Intermediate | 786 | 89.20% | 4.30% | 6.49% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 2.10% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 2.20% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232030438 | G -> A | LOC_Os02g52314.1 | upstream_gene_variant ; 3286.0bp to feature; MODIFIER | silent_mutation | Average:65.158; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg0232030438 | G -> A | LOC_Os02g52330.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.158; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232030438 | NA | 9.14E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232030438 | NA | 8.38E-07 | mr1712_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232030438 | NA | 1.21E-06 | mr1717_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232030438 | NA | 1.96E-06 | mr1722_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232030438 | NA | 1.21E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232030438 | 1.69E-06 | 3.85E-08 | mr1910_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232030438 | NA | 2.93E-07 | mr1946_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232030438 | NA | 2.93E-07 | mr1948_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |