\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0231681781:

Variant ID: vg0231681781 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 31681781
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAATATATCAACCAAACCAGAGCGATCCAAGAGATCGAATCGATGCAGCCTTGAACAACACCAACGTAGCCGATAGATTCACCAGGACCCGACAGAAC[G/A]
TAGGACTTACCCCTTCGCTGGAGATCGAAAGCCGATGCAGCCTTGCGTCAGGTGCCCAAGTTCCGCCGAAAGATAAGTAAAAACCTCAGGGAAGAGGGTG

Reverse complement sequence

CACCCTCTTCCCTGAGGTTTTTACTTATCTTTCGGCGGAACTTGGGCACCTGACGCAAGGCTGCATCGGCTTTCGATCTCCAGCGAAGGGGTAAGTCCTA[C/T]
GTTCTGTCGGGTCCTGGTGAATCTATCGGCTACGTTGGTGTTGTTCAAGGCTGCATCGATTCGATCTCTTGGATCGCTCTGGTTTGGTTGATATATTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 36.70% 0.47% 0.00% NA
All Indica  2759 96.80% 2.40% 0.80% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 97.00% 0.70% 2.35% 0.00% NA
Indica II  465 96.10% 2.60% 1.29% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.70% 0.25% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 33.30% 66.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0231681781 G -> A LOC_Os02g51720.1 upstream_gene_variant ; 1699.0bp to feature; MODIFIER silent_mutation Average:25.913; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0231681781 G -> A LOC_Os02g51710.1 downstream_gene_variant ; 4225.0bp to feature; MODIFIER silent_mutation Average:25.913; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0231681781 G -> A LOC_Os02g51730.1 downstream_gene_variant ; 4399.0bp to feature; MODIFIER silent_mutation Average:25.913; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0231681781 G -> A LOC_Os02g51710-LOC_Os02g51720 intergenic_region ; MODIFIER silent_mutation Average:25.913; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0231681781 NA 2.72E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231681781 NA 7.61E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231681781 NA 4.52E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231681781 NA 3.31E-15 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231681781 1.49E-07 1.16E-07 mr1924 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231681781 NA 1.48E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251