\
| Variant ID: vg0231643768 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 31643768 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCAAACGTCCAATATAACATCCAAAAATTTTCATTTCACCAACTAAACAGGGCCTAAATTAAATGGCCGTGATTATTGTTTGTGACAGTTTTTAAGAAT[A/C]
TTTAAGAATGCAATACTGAGAGAGAGGGAAAATACTCTCTCGCCACACACATCTCACAAATTTTTGTTGTTTTCCATGCCATTTTACGGGGAAACGATTC
GAATCGTTTCCCCGTAAAATGGCATGGAAAACAACAAAAATTTGTGAGATGTGTGTGGCGAGAGAGTATTTTCCCTCTCTCTCAGTATTGCATTCTTAAA[T/G]
ATTCTTAAAAACTGTCACAAACAATAATCACGGCCATTTAATTTAGGCCCTGTTTAGTTGGTGAAATGAAAATTTTTGGATGTTATATTGGACGTTTGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 8.20% | 2.73% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 66.90% | 24.70% | 8.33% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 43.20% | 42.50% | 14.34% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 17.40% | 5.81% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0231643768 | A -> C | LOC_Os02g51670.1 | upstream_gene_variant ; 4700.0bp to feature; MODIFIER | silent_mutation | Average:42.09; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| vg0231643768 | A -> C | LOC_Os02g51660-LOC_Os02g51670 | intergenic_region ; MODIFIER | silent_mutation | Average:42.09; most accessible tissue: Zhenshan97 root, score: 80.208 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0231643768 | NA | 1.79E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | 1.94E-06 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | 3.39E-06 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 9.16E-11 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | 1.66E-06 | NA | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | 2.87E-07 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | 1.04E-06 | NA | mr1765 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 1.11E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | 6.49E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 7.44E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 8.14E-11 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 3.56E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 6.04E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | 5.78E-06 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 2.78E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 1.05E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | 5.73E-07 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 5.33E-08 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 1.03E-07 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231643768 | NA | 4.90E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |