Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0231643768:

Variant ID: vg0231643768 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 31643768
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCAAACGTCCAATATAACATCCAAAAATTTTCATTTCACCAACTAAACAGGGCCTAAATTAAATGGCCGTGATTATTGTTTGTGACAGTTTTTAAGAAT[A/C]
TTTAAGAATGCAATACTGAGAGAGAGGGAAAATACTCTCTCGCCACACACATCTCACAAATTTTTGTTGTTTTCCATGCCATTTTACGGGGAAACGATTC

Reverse complement sequence

GAATCGTTTCCCCGTAAAATGGCATGGAAAACAACAAAAATTTGTGAGATGTGTGTGGCGAGAGAGTATTTTCCCTCTCTCTCAGTATTGCATTCTTAAA[T/G]
ATTCTTAAAAACTGTCACAAACAATAATCACGGCCATTTAATTTAGGCCCTGTTTAGTTGGTGAAATGAAAATTTTTGGATGTTATATTGGACGTTTGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 8.20% 2.73% 0.00% NA
All Indica  2759 99.60% 0.40% 0.04% 0.00% NA
All Japonica  1512 66.90% 24.70% 8.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.80% 0.13% 0.00% NA
Temperate Japonica  767 43.20% 42.50% 14.34% 0.00% NA
Tropical Japonica  504 98.40% 1.20% 0.40% 0.00% NA
Japonica Intermediate  241 76.80% 17.40% 5.81% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0231643768 A -> C LOC_Os02g51670.1 upstream_gene_variant ; 4700.0bp to feature; MODIFIER silent_mutation Average:42.09; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N
vg0231643768 A -> C LOC_Os02g51660-LOC_Os02g51670 intergenic_region ; MODIFIER silent_mutation Average:42.09; most accessible tissue: Zhenshan97 root, score: 80.208 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0231643768 NA 1.79E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 1.94E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 3.39E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 9.16E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 1.66E-06 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 2.87E-07 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 1.04E-06 NA mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 1.11E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 6.49E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 7.44E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 8.14E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 3.56E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 6.04E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 5.78E-06 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 2.78E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 1.05E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 5.73E-07 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 5.33E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 1.03E-07 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231643768 NA 4.90E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251