\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Sorry, variation is wrong, please check.

Sorry, variation is wrong, please check.

Detailed information for vg0231638633:

Variant ID: vg0231638633 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 31638633
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCAAAGTCCAAATGCTAACAAATAAAGTTGGAAGTGTTATATGGACATGGGTGCAAGCGTATATTATATCATCTACTCCCTCCGTCCCAAAAAAAGAC[G/A]
AACCCTGAGTTTCCGTGTCCAACGTTTGACCGTCCATCTTATTTGAAAAAAATATGAAAAAAATTAAAAAGATAAGTCACACATAAAGTATTAATCATGT

Reverse complement sequence

ACATGATTAATACTTTATGTGTGACTTATCTTTTTAATTTTTTTCATATTTTTTTCAAATAAGATGGACGGTCAAACGTTGGACACGGAAACTCAGGGTT[C/T]
GTCTTTTTTTGGGACGGAGGGAGTAGATGATATAATATACGCTTGCACCCATGTCCATATAACACTTCCAACTTTATTTGTTAGCATTTGGACTTTGGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 7.70% 2.69% 0.00% NA
All Indica  2759 99.60% 0.40% 0.04% 0.00% NA
All Japonica  1512 68.80% 23.00% 8.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.80% 0.13% 0.00% NA
Temperate Japonica  767 45.90% 40.20% 13.95% 0.00% NA
Tropical Japonica  504 98.40% 1.00% 0.60% 0.00% NA
Japonica Intermediate  241 79.70% 14.50% 5.81% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0231638633 G -> A LOC_Os02g51650.1 downstream_gene_variant ; 3691.0bp to feature; MODIFIER silent_mutation Average:41.154; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0231638633 G -> A LOC_Os02g51660.1 downstream_gene_variant ; 375.0bp to feature; MODIFIER silent_mutation Average:41.154; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0231638633 G -> A LOC_Os02g51660-LOC_Os02g51670 intergenic_region ; MODIFIER silent_mutation Average:41.154; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0231638633 1.17E-07 8.23E-17 mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231638633 NA 1.95E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231638633 4.16E-13 2.90E-28 mr1768_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231638633 2.01E-07 7.87E-10 mr1768_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231638633 NA 3.39E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251