\
| Variant ID: vg0231638633 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 31638633 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTCCAAAGTCCAAATGCTAACAAATAAAGTTGGAAGTGTTATATGGACATGGGTGCAAGCGTATATTATATCATCTACTCCCTCCGTCCCAAAAAAAGAC[G/A]
AACCCTGAGTTTCCGTGTCCAACGTTTGACCGTCCATCTTATTTGAAAAAAATATGAAAAAAATTAAAAAGATAAGTCACACATAAAGTATTAATCATGT
ACATGATTAATACTTTATGTGTGACTTATCTTTTTAATTTTTTTCATATTTTTTTCAAATAAGATGGACGGTCAAACGTTGGACACGGAAACTCAGGGTT[C/T]
GTCTTTTTTTGGGACGGAGGGAGTAGATGATATAATATACGCTTGCACCCATGTCCATATAACACTTCCAACTTTATTTGTTAGCATTTGGACTTTGGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.70% | 7.70% | 2.69% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 68.80% | 23.00% | 8.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 45.90% | 40.20% | 13.95% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 14.50% | 5.81% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0231638633 | G -> A | LOC_Os02g51650.1 | downstream_gene_variant ; 3691.0bp to feature; MODIFIER | silent_mutation | Average:41.154; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0231638633 | G -> A | LOC_Os02g51660.1 | downstream_gene_variant ; 375.0bp to feature; MODIFIER | silent_mutation | Average:41.154; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0231638633 | G -> A | LOC_Os02g51660-LOC_Os02g51670 | intergenic_region ; MODIFIER | silent_mutation | Average:41.154; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0231638633 | 1.17E-07 | 8.23E-17 | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231638633 | NA | 1.95E-06 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231638633 | 4.16E-13 | 2.90E-28 | mr1768_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231638633 | 2.01E-07 | 7.87E-10 | mr1768_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231638633 | NA | 3.39E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |