RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0231638633:

Variant ID: vg0231638633 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 31638633
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCAAAGTCCAAATGCTAACAAATAAAGTTGGAAGTGTTATATGGACATGGGTGCAAGCGTATATTATATCATCTACTCCCTCCGTCCCAAAAAAAGAC[G/A]
AACCCTGAGTTTCCGTGTCCAACGTTTGACCGTCCATCTTATTTGAAAAAAATATGAAAAAAATTAAAAAGATAAGTCACACATAAAGTATTAATCATGT

Reverse complement sequence

ACATGATTAATACTTTATGTGTGACTTATCTTTTTAATTTTTTTCATATTTTTTTCAAATAAGATGGACGGTCAAACGTTGGACACGGAAACTCAGGGTT[C/T]
GTCTTTTTTTGGGACGGAGGGAGTAGATGATATAATATACGCTTGCACCCATGTCCATATAACACTTCCAACTTTATTTGTTAGCATTTGGACTTTGGAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.70%	7.70%	2.69%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.04%	0.00%	NA
All Japonica	1512	68.80%	23.00%	8.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.80%	0.13%	0.00%	NA
Temperate Japonica	767	45.90%	40.20%	13.95%	0.00%	NA
Tropical Japonica	504	98.40%	1.00%	0.60%	0.00%	NA
Japonica Intermediate	241	79.70%	14.50%	5.81%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	4.40%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0231638633	G -> A	LOC_Os02g51650.1	downstream_gene_variant ; 3691.0bp to feature; MODIFIER	silent_mutation	Average:41.154; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0231638633	G -> A	LOC_Os02g51660.1	downstream_gene_variant ; 375.0bp to feature; MODIFIER	silent_mutation	Average:41.154; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0231638633	G -> A	LOC_Os02g51660-LOC_Os02g51670	intergenic_region ; MODIFIER	silent_mutation	Average:41.154; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0231638633	1.17E-07	8.23E-17	mr1768	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231638633	NA	1.95E-06	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231638633	4.16E-13	2.90E-28	mr1768_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231638633	2.01E-07	7.87E-10	mr1768_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231638633	NA	3.39E-07	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0231638633:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact