Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0231466195:

Variant ID: vg0231466195 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 31466195
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

TGTACTCCCTCCGTTAAAAAAAAAGTCAAACCCTGAATTTCCGTGTCAACGTTTGACTATCCGTCTTATATGAATTTTTTTTATAATTAGTATTTTCATT[G/A]
TTGTTAGATGATAAAACATAATTAATACTTTATGCGTTACTTATCTTTTTAATTTTTTTCATATTTTTTTAAATAAGACGAACGGTCAAATGTTGAACAC

Reverse complement sequence

GTGTTCAACATTTGACCGTTCGTCTTATTTAAAAAAATATGAAAAAAATTAAAAAGATAAGTAACGCATAAAGTATTAATTATGTTTTATCATCTAACAA[C/T]
AATGAAAATACTAATTATAAAAAAAATTCATATAAGACGGATAGTCAAACGTTGACACGGAAATTCAGGGTTTGACTTTTTTTTTAACGGAGGGAGTACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.40%	43.40%	2.45%	1.74%	NA
All Indica	2759	85.20%	7.80%	4.06%	2.97%	NA
All Japonica	1512	0.30%	99.60%	0.07%	0.00%	NA
Aus	269	36.40%	63.60%	0.00%	0.00%	NA
Indica I	595	88.20%	2.00%	6.22%	3.53%	NA
Indica II	465	86.00%	6.70%	4.30%	3.01%	NA
Indica III	913	91.70%	2.80%	2.63%	2.85%	NA
Indica Intermediate	786	74.90%	18.40%	3.94%	2.67%	NA
Temperate Japonica	767	0.40%	99.50%	0.13%	0.00%	NA
Tropical Japonica	504	0.00%	100.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	25.60%	71.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0231466195	G -> A	LOC_Os02g51370.1	upstream_gene_variant ; 3351.0bp to feature; MODIFIER	silent_mutation	Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53	N	N	N	N
vg0231466195	G -> A	LOC_Os02g51380.1	upstream_gene_variant ; 340.0bp to feature; MODIFIER	silent_mutation	Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53	N	N	N	N
vg0231466195	G -> A	LOC_Os02g51390.1	upstream_gene_variant ; 1200.0bp to feature; MODIFIER	silent_mutation	Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53	N	N	N	N
vg0231466195	G -> A	LOC_Os02g51390.2	upstream_gene_variant ; 1200.0bp to feature; MODIFIER	silent_mutation	Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53	N	N	N	N
vg0231466195	G -> A	LOC_Os02g51380-LOC_Os02g51390	intergenic_region ; MODIFIER	silent_mutation	Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53	N	N	N	N
vg0231466195	G -> DEL	N	N	silent_mutation	Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0231466195	G	A	0.0	0.01	0.0	0.01	0.0	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0231466195	NA	1.87E-09	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195	NA	1.32E-07	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195	1.64E-06	1.65E-08	mr1027_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195	NA	6.81E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195	NA	3.28E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195	NA	3.56E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195	NA	1.60E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195	NA	8.68E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195	NA	1.02E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195	NA	2.90E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195	NA	2.89E-14	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251