Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0231466195:

Variant ID: vg0231466195 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 31466195
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TGTACTCCCTCCGTTAAAAAAAAAGTCAAACCCTGAATTTCCGTGTCAACGTTTGACTATCCGTCTTATATGAATTTTTTTTATAATTAGTATTTTCATT[G/A]
TTGTTAGATGATAAAACATAATTAATACTTTATGCGTTACTTATCTTTTTAATTTTTTTCATATTTTTTTAAATAAGACGAACGGTCAAATGTTGAACAC

Reverse complement sequence

GTGTTCAACATTTGACCGTTCGTCTTATTTAAAAAAATATGAAAAAAATTAAAAAGATAAGTAACGCATAAAGTATTAATTATGTTTTATCATCTAACAA[C/T]
AATGAAAATACTAATTATAAAAAAAATTCATATAAGACGGATAGTCAAACGTTGACACGGAAATTCAGGGTTTGACTTTTTTTTTAACGGAGGGAGTACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 43.40% 2.45% 1.74% NA
All Indica  2759 85.20% 7.80% 4.06% 2.97% NA
All Japonica  1512 0.30% 99.60% 0.07% 0.00% NA
Aus  269 36.40% 63.60% 0.00% 0.00% NA
Indica I  595 88.20% 2.00% 6.22% 3.53% NA
Indica II  465 86.00% 6.70% 4.30% 3.01% NA
Indica III  913 91.70% 2.80% 2.63% 2.85% NA
Indica Intermediate  786 74.90% 18.40% 3.94% 2.67% NA
Temperate Japonica  767 0.40% 99.50% 0.13% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 25.60% 71.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0231466195 G -> A LOC_Os02g51370.1 upstream_gene_variant ; 3351.0bp to feature; MODIFIER silent_mutation Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53 N N N N
vg0231466195 G -> A LOC_Os02g51380.1 upstream_gene_variant ; 340.0bp to feature; MODIFIER silent_mutation Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53 N N N N
vg0231466195 G -> A LOC_Os02g51390.1 upstream_gene_variant ; 1200.0bp to feature; MODIFIER silent_mutation Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53 N N N N
vg0231466195 G -> A LOC_Os02g51390.2 upstream_gene_variant ; 1200.0bp to feature; MODIFIER silent_mutation Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53 N N N N
vg0231466195 G -> A LOC_Os02g51380-LOC_Os02g51390 intergenic_region ; MODIFIER silent_mutation Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53 N N N N
vg0231466195 G -> DEL N N silent_mutation Average:81.755; most accessible tissue: Minghui63 flower, score: 95.53 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0231466195 G A 0.0 0.01 0.0 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0231466195 NA 1.87E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195 NA 1.32E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195 1.64E-06 1.65E-08 mr1027_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195 NA 6.81E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195 NA 3.28E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195 NA 3.56E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195 NA 1.60E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195 NA 8.68E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195 NA 1.02E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195 NA 2.90E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0231466195 NA 2.89E-14 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251