\
| Variant ID: vg0231389934 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 31389934 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGACCCCTGGAGATGTACTAGAATGCCCCCACAGACGCTGATGTGGCAGGGGCATTAGAGTAAACTTACAAAGACCCACAGGGGTAAAAATGTAATCTCA[C/T]
GTGTACGACCACCGGTTATAAAAGCCAATCAAAAACCTGTAGCAGGACAAGACATCTTGAATACAAAAGTAATCCTCAAAAGTTGTGTTTGCTGTTCGAG
CTCGAACAGCAAACACAACTTTTGAGGATTACTTTTGTATTCAAGATGTCTTGTCCTGCTACAGGTTTTTGATTGGCTTTTATAACCGGTGGTCGTACAC[G/A]
TGAGATTACATTTTTACCCCTGTGGGTCTTTGTAAGTTTACTCTAATGCCCCTGCCACATCAGCGTCTGTGGGGGCATTCTAGTACATCTCCAGGGGTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 3.20% | 3.87% | 5.52% | NA |
| All Indica | 2759 | 87.00% | 0.50% | 5.55% | 7.00% | NA |
| All Japonica | 1512 | 90.60% | 8.60% | 0.79% | 0.00% | NA |
| Aus | 269 | 69.90% | 0.00% | 5.58% | 24.54% | NA |
| Indica I | 595 | 93.10% | 0.00% | 3.03% | 3.87% | NA |
| Indica II | 465 | 91.40% | 1.10% | 2.58% | 4.95% | NA |
| Indica III | 913 | 79.70% | 0.50% | 8.32% | 11.39% | NA |
| Indica Intermediate | 786 | 88.00% | 0.50% | 5.98% | 5.47% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 72.80% | 25.20% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0231389934 | C -> T | LOC_Os02g51260.1 | upstream_gene_variant ; 1375.0bp to feature; MODIFIER | silent_mutation | Average:20.887; most accessible tissue: Callus, score: 38.807 | N | N | N | N |
| vg0231389934 | C -> T | LOC_Os02g51270.1 | upstream_gene_variant ; 188.0bp to feature; MODIFIER | silent_mutation | Average:20.887; most accessible tissue: Callus, score: 38.807 | N | N | N | N |
| vg0231389934 | C -> T | LOC_Os02g51260-LOC_Os02g51270 | intergenic_region ; MODIFIER | silent_mutation | Average:20.887; most accessible tissue: Callus, score: 38.807 | N | N | N | N |
| vg0231389934 | C -> DEL | N | N | silent_mutation | Average:20.887; most accessible tissue: Callus, score: 38.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0231389934 | NA | 2.17E-06 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231389934 | NA | 7.27E-06 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231389934 | 2.90E-07 | 4.53E-12 | mr1771_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231389934 | 9.79E-06 | 4.78E-11 | mr1784_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231389934 | 5.14E-07 | 5.18E-13 | mr1800_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231389934 | NA | 2.52E-09 | mr1862_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |