\
| Variant ID: vg0231332457 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 31332457 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 117. )
CAGAGTCGGCGAAGCATGAGGTGGCGGTGAGGCGGCCTGCAAAGGCGACACGTCCCCCACTGGGCAGTCTATCGCTGCCGTCGCCGCCAGCTCGAGCCGC[A/T]
ACAGCGCTTCTTCAACTTGTTGGCATGTGGTCGCCGCAGTCGGCGGTGGCAGGTTCGACTTGATGCGCGCGAAGACGCTCTCCACCGGGATCGGCTTCCA
TGGAAGCCGATCCCGGTGGAGAGCGTCTTCGCGCGCATCAAGTCGAACCTGCCACCGCCGACTGCGGCGACCACATGCCAACAAGTTGAAGAAGCGCTGT[T/A]
GCGGCTCGAGCTGGCGGCGACGGCAGCGATAGACTGCCCAGTGGGGGACGTGTCGCCTTTGCAGGCCGCCTCACCGCCACCTCATGCTTCGCCGACTCTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 6.00% | 1.10% | 0.00% | NA |
| All Indica | 2759 | 88.00% | 10.10% | 1.85% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.00% | 1.01% | 0.00% | NA |
| Indica II | 465 | 68.20% | 27.50% | 4.30% | 0.00% | NA |
| Indica III | 913 | 93.40% | 6.10% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 85.10% | 12.20% | 2.67% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0231332457 | A -> T | LOC_Os02g51200.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.93; most accessible tissue: Zhenshan97 young leaf, score: 80.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0231332457 | NA | 1.40E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231332457 | 7.61E-07 | 7.59E-07 | mr1473_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231332457 | 9.55E-06 | 9.54E-06 | mr1473_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231332457 | NA | 3.97E-07 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231332457 | 6.86E-07 | 6.84E-07 | mr1630_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0231332457 | 8.18E-07 | 8.16E-07 | mr1848_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |