\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230805438:

Variant ID: vg0230805438 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30805438
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCTAAACGATGTGTTTCGTGCGAAAACTTTTTATATGAAAGTTGCTCTAAAATATCATCTTGATCTATTTTTCAAGTTTGTAATAATTAAAACTCAAT[C/T]
AATCATACGTTAATACCACCTCGTTTTGCGTAAAAAAAACTTAATCTTCATCTTCATTTTTATTTTTATTTTCAGGAGAAAAGAACACTCTGGTTTCTCA

Reverse complement sequence

TGAGAAACCAGAGTGTTCTTTTCTCCTGAAAATAAAAATAAAAATGAAGATGAAGATTAAGTTTTTTTTACGCAAAACGAGGTGGTATTAACGTATGATT[G/A]
ATTGAGTTTTAATTATTACAAACTTGAAAAATAGATCAAGATGATATTTTAGAGCAACTTTCATATAAAAAGTTTTCGCACGAAACACATCGTTTAGCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 6.60% 0.06% 0.00% NA
All Indica  2759 88.80% 11.20% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 63.90% 35.90% 0.22% 0.00% NA
Indica III  913 96.20% 3.70% 0.11% 0.00% NA
Indica Intermediate  786 86.40% 13.60% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230805438 C -> T LOC_Os02g50450.1 downstream_gene_variant ; 2903.0bp to feature; MODIFIER silent_mutation Average:40.132; most accessible tissue: Callus, score: 85.875 N N N N
vg0230805438 C -> T LOC_Os02g50460.1 downstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:40.132; most accessible tissue: Callus, score: 85.875 N N N N
vg0230805438 C -> T LOC_Os02g50450-LOC_Os02g50460 intergenic_region ; MODIFIER silent_mutation Average:40.132; most accessible tissue: Callus, score: 85.875 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230805438 1.48E-07 1.48E-07 mr1313_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230805438 1.15E-06 1.15E-06 mr1313_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230805438 4.14E-08 4.13E-08 mr1473_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230805438 9.43E-07 9.43E-07 mr1473_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230805438 NA 2.16E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230805438 1.13E-07 1.13E-07 mr1630_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230805438 2.20E-06 2.20E-06 mr1630_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230805438 NA 8.51E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251