\
| Variant ID: vg0230805438 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 30805438 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 116. )
CTGCTAAACGATGTGTTTCGTGCGAAAACTTTTTATATGAAAGTTGCTCTAAAATATCATCTTGATCTATTTTTCAAGTTTGTAATAATTAAAACTCAAT[C/T]
AATCATACGTTAATACCACCTCGTTTTGCGTAAAAAAAACTTAATCTTCATCTTCATTTTTATTTTTATTTTCAGGAGAAAAGAACACTCTGGTTTCTCA
TGAGAAACCAGAGTGTTCTTTTCTCCTGAAAATAAAAATAAAAATGAAGATGAAGATTAAGTTTTTTTTACGCAAAACGAGGTGGTATTAACGTATGATT[G/A]
ATTGAGTTTTAATTATTACAAACTTGAAAAATAGATCAAGATGATATTTTAGAGCAACTTTCATATAAAAAGTTTTCGCACGAAACACATCGTTTAGCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 6.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 88.80% | 11.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 63.90% | 35.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.20% | 3.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 13.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0230805438 | C -> T | LOC_Os02g50450.1 | downstream_gene_variant ; 2903.0bp to feature; MODIFIER | silent_mutation | Average:40.132; most accessible tissue: Callus, score: 85.875 | N | N | N | N |
| vg0230805438 | C -> T | LOC_Os02g50460.1 | downstream_gene_variant ; 549.0bp to feature; MODIFIER | silent_mutation | Average:40.132; most accessible tissue: Callus, score: 85.875 | N | N | N | N |
| vg0230805438 | C -> T | LOC_Os02g50450-LOC_Os02g50460 | intergenic_region ; MODIFIER | silent_mutation | Average:40.132; most accessible tissue: Callus, score: 85.875 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0230805438 | 1.48E-07 | 1.48E-07 | mr1313_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230805438 | 1.15E-06 | 1.15E-06 | mr1313_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230805438 | 4.14E-08 | 4.13E-08 | mr1473_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230805438 | 9.43E-07 | 9.43E-07 | mr1473_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230805438 | NA | 2.16E-06 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230805438 | 1.13E-07 | 1.13E-07 | mr1630_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230805438 | 2.20E-06 | 2.20E-06 | mr1630_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230805438 | NA | 8.51E-07 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |