Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230671125:

Variant ID: vg0230671125 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 30671125
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AATTAGATAAGATTCAAATAGCACATAGCGTGGATTGTATGACACCTACTCCATAATACCATAAGTTGCTACATGTAACTGTGCAACTATTATAACTCCT[A/T]
TGGAAAGAAATTATTGTTTACAGTGTACTACACCTTGAATTTTCATTTATCGATTATTGAGAAGATGAGCCAATCTATAGTTGAGACAGTGGTTTTAATA

Reverse complement sequence

TATTAAAACCACTGTCTCAACTATAGATTGGCTCATCTTCTCAATAATCGATAAATGAAAATTCAAGGTGTAGTACACTGTAAACAATAATTTCTTTCCA[T/A]
AGGAGTTATAATAGTTGCACAGTTACATGTAGCAACTTATGGTATTATGGAGTAGGTGTCATACAATCCACGCTATGTGCTATTTGAATCTTATCTAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	44.90%	0.08%	0.38%	NA
All Indica	2759	83.80%	15.50%	0.11%	0.62%	NA
All Japonica	1512	0.40%	99.60%	0.00%	0.00%	NA
Aus	269	88.10%	11.50%	0.00%	0.37%	NA
Indica I	595	93.40%	6.20%	0.00%	0.34%	NA
Indica II	465	82.40%	16.80%	0.22%	0.65%	NA
Indica III	913	75.60%	23.70%	0.00%	0.77%	NA
Indica Intermediate	786	86.80%	12.30%	0.25%	0.64%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.00%	100.00%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	32.20%	66.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230671125	A -> T	LOC_Os02g50240.1	downstream_gene_variant ; 3651.0bp to feature; MODIFIER	silent_mutation	Average:56.321; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0230671125	A -> T	LOC_Os02g50240.2	downstream_gene_variant ; 3651.0bp to feature; MODIFIER	silent_mutation	Average:56.321; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0230671125	A -> T	LOC_Os02g50230.1	intron_variant ; MODIFIER	silent_mutation	Average:56.321; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0230671125	A -> DEL	N	N	silent_mutation	Average:56.321; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230671125	NA	1.13E-13	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	3.45E-11	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	1.80E-07	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	9.06E-13	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	4.82E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	3.10E-12	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	3.86E-15	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	2.80E-32	mr1414	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	3.43E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	5.27E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	2.20E-10	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	1.58E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	1.23E-20	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	2.80E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	2.03E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	1.38E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	8.94E-15	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	2.06E-07	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	8.16E-07	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230671125	NA	3.02E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251