Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0230571236:

Variant ID: vg0230571236 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30571236
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCTCCTCCCCTCCTCCATCTCCGACCACCGTGCATCCCCTCCTCCATCTCCGGCCGTTGTGCCTTCCCTTCTTTTCTCTTGCCGCCAAGTCTTCCCTT[C/T]
CTCCTCCGTGCATGGATCCATGTTCATTGTTACCAAATTGAGTTTAGACGGCGCGAATCGTTCTTCGGCAGTGTGAATTGAGCTCGGGTGGGGCGAAGCA

Reverse complement sequence

TGCTTCGCCCCACCCGAGCTCAATTCACACTGCCGAAGAACGATTCGCGCCGTCTAAACTCAATTTGGTAACAATGAACATGGATCCATGCACGGAGGAG[G/A]
AAGGGAAGACTTGGCGGCAAGAGAAAAGAAGGGAAGGCACAACGGCCGGAGATGGAGGAGGGGATGCACGGTGGTCGGAGATGGAGGAGGGGAGGAGCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 39.70% 0.06% 0.40% NA
All Indica  2759 93.20% 6.20% 0.11% 0.54% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 82.90% 17.10% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.00% 0.17% NA
Indica II  465 88.00% 11.00% 0.65% 0.43% NA
Indica III  913 94.00% 5.70% 0.00% 0.33% NA
Indica Intermediate  786 91.10% 7.80% 0.00% 1.15% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 28.90% 66.70% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230571236 C -> T LOC_Os02g50040.1 upstream_gene_variant ; 2167.0bp to feature; MODIFIER silent_mutation Average:79.21; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0230571236 C -> T LOC_Os02g50030.1 downstream_gene_variant ; 4477.0bp to feature; MODIFIER silent_mutation Average:79.21; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0230571236 C -> T LOC_Os02g50030-LOC_Os02g50040 intergenic_region ; MODIFIER silent_mutation Average:79.21; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0230571236 C -> DEL N N silent_mutation Average:79.21; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0230571236 C T -0.06 -0.04 -0.04 -0.04 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230571236 5.62E-06 2.18E-07 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 4.61E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 9.60E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 2.52E-08 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 3.51E-06 9.03E-07 mr1109 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 1.44E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 3.79E-06 NA mr1136 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 1.97E-06 1.32E-08 mr1235 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 2.67E-06 mr1243 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 6.82E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 7.51E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 1.68E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 3.28E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 4.01E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 1.06E-08 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 7.06E-07 3.50E-09 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 1.82E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 5.21E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 5.03E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230571236 NA 5.25E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251