\
| Variant ID: vg0230481430 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 30481430 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, T: 0.40, others allele: 0.00, population size: 63. )
CAAATTAACCCAACAACTTTTGTAACCTAAAAAAGCTTACAAAAATGGTATAACACCTTTCTGTCAGGCACATTTTCATGTGCATCATAATAATTCCAAA[T/G]
AATTATTGAATCGCGTTAAAAAGGATTTTAACAGCATCGGGCCGCATCATTGTGAGCACATATTGCCAAAGCAAAAAGCGCCTAAGTCCCTAGGGATCAC
GTGATCCCTAGGGACTTAGGCGCTTTTTGCTTTGGCAATATGTGCTCACAATGATGCGGCCCGATGCTGTTAAAATCCTTTTTAACGCGATTCAATAATT[A/C]
TTTGGAATTATTATGATGCACATGAAAATGTGCCTGACAGAAAGGTGTTATACCATTTTTGTAAGCTTTTTTAGGTTACAAAAGTTGTTGGGTTAATTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.00% | 40.80% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 91.90% | 7.70% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.70% | 19.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 86.70% | 12.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 92.70% | 7.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 9.40% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 31.10% | 68.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0230481430 | T -> G | LOC_Os02g49890.1 | upstream_gene_variant ; 399.0bp to feature; MODIFIER | silent_mutation | Average:54.068; most accessible tissue: Minghui63 flag leaf, score: 82.75 | N | N | N | N |
| vg0230481430 | T -> G | LOC_Os02g49900.1 | downstream_gene_variant ; 3660.0bp to feature; MODIFIER | silent_mutation | Average:54.068; most accessible tissue: Minghui63 flag leaf, score: 82.75 | N | N | N | N |
| vg0230481430 | T -> G | LOC_Os02g49880-LOC_Os02g49890 | intergenic_region ; MODIFIER | silent_mutation | Average:54.068; most accessible tissue: Minghui63 flag leaf, score: 82.75 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0230481430 | NA | 5.60E-06 | mr1129 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230481430 | NA | 6.62E-07 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |