\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230403360:

Variant ID: vg0230403360 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30403360
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTTTTTTATTTTTTTGCCTTTTTTTCACGGAATTTGATTTTTTTTTTCGCCTGTTTTTTTTCTCCCGGTTTTTTCGCTCGTCCGATTTTTTTCGCTG[G/T]
TTTATTTACGGACGACGGAAGCACCTTTTTTTTAAGTATAGTAGAGGTAGAGATAGAAATTTTTTAACCGCGTCACATATAATTCCTTTTTCTTTGAAAT

Reverse complement sequence

ATTTCAAAGAAAAAGGAATTATATGTGACGCGGTTAAAAAATTTCTATCTCTACCTCTACTATACTTAAAAAAAAGGTGCTTCCGTCGTCCGTAAATAAA[C/A]
CAGCGAAAAAAATCGGACGAGCGAAAAAACCGGGAGAAAAAAAACAGGCGAAAAAAAAAATCAAATTCCGTGAAAAAAAGGCAAAAAAATAAAAAAGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 25.80% 0.66% 0.00% NA
All Indica  2759 55.30% 43.60% 1.12% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 20.50% 77.00% 2.52% 0.00% NA
Indica II  465 75.30% 24.10% 0.65% 0.00% NA
Indica III  913 58.50% 40.70% 0.77% 0.00% NA
Indica Intermediate  786 66.20% 33.10% 0.76% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230403360 G -> T LOC_Os02g49740.1 upstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0230403360 G -> T LOC_Os02g49750.1 downstream_gene_variant ; 3908.0bp to feature; MODIFIER silent_mutation Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0230403360 G -> T LOC_Os02g49730.1 intron_variant ; MODIFIER silent_mutation Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230403360 NA 7.10E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 1.69E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 7.71E-08 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 1.23E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 9.48E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 1.05E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 3.90E-09 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 8.91E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 6.76E-23 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 6.91E-10 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 1.38E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 1.05E-06 mr1631_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 1.70E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 2.65E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 3.63E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 4.41E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 6.95E-06 mr1757_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 1.51E-15 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 3.15E-11 mr1904_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360 NA 1.42E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251