Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230403360:

Variant ID: vg0230403360 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 30403360
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTTTTTTATTTTTTTGCCTTTTTTTCACGGAATTTGATTTTTTTTTTCGCCTGTTTTTTTTCTCCCGGTTTTTTCGCTCGTCCGATTTTTTTCGCTG[G/T]
TTTATTTACGGACGACGGAAGCACCTTTTTTTTAAGTATAGTAGAGGTAGAGATAGAAATTTTTTAACCGCGTCACATATAATTCCTTTTTCTTTGAAAT

Reverse complement sequence

ATTTCAAAGAAAAAGGAATTATATGTGACGCGGTTAAAAAATTTCTATCTCTACCTCTACTATACTTAAAAAAAAGGTGCTTCCGTCGTCCGTAAATAAA[C/A]
CAGCGAAAAAAATCGGACGAGCGAAAAAACCGGGAGAAAAAAAACAGGCGAAAAAAAAAATCAAATTCCGTGAAAAAAAGGCAAAAAAATAAAAAAGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.60%	25.80%	0.66%	0.00%	NA
All Indica	2759	55.30%	43.60%	1.12%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	20.50%	77.00%	2.52%	0.00%	NA
Indica II	465	75.30%	24.10%	0.65%	0.00%	NA
Indica III	913	58.50%	40.70%	0.77%	0.00%	NA
Indica Intermediate	786	66.20%	33.10%	0.76%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230403360	G -> T	LOC_Os02g49740.1	upstream_gene_variant ; 1721.0bp to feature; MODIFIER	silent_mutation	Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0230403360	G -> T	LOC_Os02g49750.1	downstream_gene_variant ; 3908.0bp to feature; MODIFIER	silent_mutation	Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0230403360	G -> T	LOC_Os02g49730.1	intron_variant ; MODIFIER	silent_mutation	Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230403360	NA	7.10E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	1.69E-09	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	7.71E-08	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	1.23E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	9.48E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	1.05E-06	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	3.90E-09	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	8.91E-06	mr1272_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	6.76E-23	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	6.91E-10	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	1.38E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	1.05E-06	mr1631_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	1.70E-09	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	2.65E-06	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	3.63E-06	mr1679_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	4.41E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	6.95E-06	mr1757_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	1.51E-15	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	3.15E-11	mr1904_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230403360	NA	1.42E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251