\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230392490:

Variant ID: vg0230392490 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30392490
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GACCACTCGTCTTATTTAAATTTTTTTTAAATTATTATTTATTTTATTTGTGACTTACTTTATTATCTACAGTATTTTAAGCACAACTTTTTGTTTTTTA[T/C]
ATTTAAAAAAAATTGAATAAGACGAGTGGTCAAACGTTATGATAAAAACTCAAAATCAGCAAATATTGGTACTTGGTAAATGGTTCAGTTTTCAGATGCC

Reverse complement sequence

GGCATCTGAAAACTGAACCATTTACCAAGTACCAATATTTGCTGATTTTGAGTTTTTATCATAACGTTTGACCACTCGTCTTATTCAATTTTTTTTAAAT[A/G]
TAAAAAACAAAAAGTTGTGCTTAAAATACTGTAGATAATAAAGTAAGTCACAAATAAAATAAATAATAATTTAAAAAAAATTTAAATAAGACGAGTGGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 28.00% 0.57% 0.00% NA
All Indica  2759 51.90% 47.30% 0.83% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 15.30% 83.40% 1.34% 0.00% NA
Indica II  465 74.40% 25.20% 0.43% 0.00% NA
Indica III  913 54.80% 44.70% 0.55% 0.00% NA
Indica Intermediate  786 62.80% 36.10% 1.02% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230392490 T -> C LOC_Os02g49710.1 downstream_gene_variant ; 1194.0bp to feature; MODIFIER silent_mutation Average:66.741; most accessible tissue: Callus, score: 97.2 N N N N
vg0230392490 T -> C LOC_Os02g49720.1 downstream_gene_variant ; 57.0bp to feature; MODIFIER silent_mutation Average:66.741; most accessible tissue: Callus, score: 97.2 N N N N
vg0230392490 T -> C LOC_Os02g49720.2 downstream_gene_variant ; 57.0bp to feature; MODIFIER silent_mutation Average:66.741; most accessible tissue: Callus, score: 97.2 N N N N
vg0230392490 T -> C LOC_Os02g49720.3 downstream_gene_variant ; 57.0bp to feature; MODIFIER silent_mutation Average:66.741; most accessible tissue: Callus, score: 97.2 N N N N
vg0230392490 T -> C LOC_Os02g49720.7 downstream_gene_variant ; 57.0bp to feature; MODIFIER silent_mutation Average:66.741; most accessible tissue: Callus, score: 97.2 N N N N
vg0230392490 T -> C LOC_Os02g49720.6 downstream_gene_variant ; 57.0bp to feature; MODIFIER silent_mutation Average:66.741; most accessible tissue: Callus, score: 97.2 N N N N
vg0230392490 T -> C LOC_Os02g49710-LOC_Os02g49720 intergenic_region ; MODIFIER silent_mutation Average:66.741; most accessible tissue: Callus, score: 97.2 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0230392490 T C -0.03 -0.02 -0.01 -0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230392490 NA 2.97E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 9.70E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 1.01E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 2.36E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 9.40E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 7.68E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 2.18E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 6.66E-08 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 3.50E-09 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 7.60E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 2.48E-25 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 1.03E-11 mr1531_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 5.66E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 3.81E-14 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 1.67E-09 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230392490 NA 1.13E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251