\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230371738:

Variant ID: vg0230371738 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30371738
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


ATAACATCTAAAATATGTTTTTATAAAATTAAATAAGTATCTTCATATTAGTATTACTATTAGGCTCTGTTCGTTCTGGGGAGATTGGGTCTCGTTTTCC[A/G]
GACTCATGCTTTTCAAACTATTAAACGATGCATTTTTTTTAAAAAAAATCTATAGGAAAGTTGCTTTAAAAAATCATAGAGTAAAGTGCACTAGCGGTCC

Reverse complement sequence

GGACCGCTAGTGCACTTTACTCTATGATTTTTTAAAGCAACTTTCCTATAGATTTTTTTTAAAAAAAATGCATCGTTTAATAGTTTGAAAAGCATGAGTC[T/C]
GGAAAACGAGACCCAATCTCCCCAGAACGAACAGAGCCTAATAGTAATACTAATATGAAGATACTTATTTAATTTTATAAAAACATATTTTAGATGTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.90% 0.02% 0.00% NA
All Indica  2759 97.90% 2.10% 0.04% 0.00% NA
All Japonica  1512 0.40% 99.60% 0.00% 0.00% NA
Aus  269 87.00% 13.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.17% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230371738 A -> G LOC_Os02g49690-LOC_Os02g49700 intergenic_region ; MODIFIER silent_mutation Average:52.229; most accessible tissue: Callus, score: 72.111 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230371738 NA 5.24E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 2.95E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 3.50E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.39E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 2.40E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 2.66E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.67E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 6.98E-28 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 5.59E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.53E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.62E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 5.12E-17 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 5.29E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 7.48E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.14E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.35E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 5.33E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 7.48E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 7.56E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 5.75E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.04E-26 mr1571 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 4.02E-14 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 3.77E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 2.23E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 3.22E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 3.76E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 5.65E-26 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 4.12E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.67E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 5.40E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 4.66E-60 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 6.59E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 7.57E-113 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 9.74E-12 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.93E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.82E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.06E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 1.82E-100 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 9.98E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230371738 NA 2.56E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251