\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230370414:

Variant ID: vg0230370414 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30370414
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGTCCATGTATCCGTGTCTCAACTTTACCTGCAGTTATGGAAGATGATCTGCATCTAGAACCAGGGGCGGATCCAACGTGGGTGCAAGGCGACTCGA[G/A]
TCCCCCCTACACCCAAAAGACCCATGGATACCCCCTGAGCACCCCCTTAAATTTTTTCACCATGAATAATAAGCTAAAGGTCCTTAGATGGCTGGAGGTT

Reverse complement sequence

AACCTCCAGCCATCTAAGGACCTTTAGCTTATTATTCATGGTGAAAAAATTTAAGGGGGTGCTCAGGGGGTATCCATGGGTCTTTTGGGTGTAGGGGGGA[C/T]
TCGAGTCGCCTTGCACCCACGTTGGATCCGCCCCTGGTTCTAGATGCAGATCATCTTCCATAACTGCAGGTAAAGTTGAGACACGGATACATGGACATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 29.90% 0.49% 0.51% NA
All Indica  2759 48.50% 49.80% 0.83% 0.83% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 11.90% 87.10% 0.17% 0.84% NA
Indica II  465 74.60% 25.20% 0.00% 0.22% NA
Indica III  913 52.20% 44.20% 2.08% 1.42% NA
Indica Intermediate  786 56.50% 42.60% 0.38% 0.51% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230370414 G -> A LOC_Os02g49690.1 downstream_gene_variant ; 4592.0bp to feature; MODIFIER silent_mutation Average:64.526; most accessible tissue: Minghui63 flower, score: 76.374 N N N N
vg0230370414 G -> A LOC_Os02g49690-LOC_Os02g49700 intergenic_region ; MODIFIER silent_mutation Average:64.526; most accessible tissue: Minghui63 flower, score: 76.374 N N N N
vg0230370414 G -> DEL N N silent_mutation Average:64.526; most accessible tissue: Minghui63 flower, score: 76.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230370414 NA 3.00E-15 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 9.68E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 5.73E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 1.37E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 3.46E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 2.65E-06 NA mr1094_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 6.44E-06 6.32E-08 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 3.52E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 2.30E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 2.02E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 1.90E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 6.48E-23 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 1.14E-10 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 2.50E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 8.37E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 9.42E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 4.74E-06 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 9.98E-14 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 4.28E-09 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230370414 NA 1.87E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251