\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230309897:

Variant ID: vg0230309897 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30309897
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTTGCTCTTAGAGCACCCGCAATGGTAAAGTAAGGTGCTATATATAAAACATGTATATCTCAGTAATAGACTCGATTAATAGTAAACCACCTCAATG[G/A]
TATGTCTACATCGGTATCTATAGCTCTCTAATGCATTGCCTCGTTTTTCTCTATAGACTATCTCCAGGTTAGTAGATAGCTTTGCTCTCTCTCTTCATGT

Reverse complement sequence

ACATGAAGAGAGAGAGCAAAGCTATCTACTAACCTGGAGATAGTCTATAGAGAAAAACGAGGCAATGCATTAGAGAGCTATAGATACCGATGTAGACATA[C/T]
CATTGAGGTGGTTTACTATTAATCGAGTCTATTACTGAGATATACATGTTTTATATATAGCACCTTACTTTACCATTGCGGGTGCTCTAAGAGCAAAGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 49.20% 0.00% 0.00% NA
All Indica  2759 17.30% 82.70% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 7.60% 92.40% 0.00% 0.00% NA
Indica II  465 6.00% 94.00% 0.00% 0.00% NA
Indica III  913 25.10% 74.90% 0.00% 0.00% NA
Indica Intermediate  786 22.40% 77.60% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230309897 G -> A LOC_Os02g49570.1 upstream_gene_variant ; 3728.0bp to feature; MODIFIER silent_mutation Average:72.484; most accessible tissue: Minghui63 flower, score: 87.162 N N N N
vg0230309897 G -> A LOC_Os02g49580.1 upstream_gene_variant ; 345.0bp to feature; MODIFIER silent_mutation Average:72.484; most accessible tissue: Minghui63 flower, score: 87.162 N N N N
vg0230309897 G -> A LOC_Os02g49590.1 upstream_gene_variant ; 640.0bp to feature; MODIFIER silent_mutation Average:72.484; most accessible tissue: Minghui63 flower, score: 87.162 N N N N
vg0230309897 G -> A LOC_Os02g49580-LOC_Os02g49590 intergenic_region ; MODIFIER silent_mutation Average:72.484; most accessible tissue: Minghui63 flower, score: 87.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230309897 NA 5.52E-32 mr1037 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 8.35E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 2.73E-35 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 8.24E-35 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 4.68E-43 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 3.35E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 1.08E-06 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 2.22E-56 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 2.29E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 2.09E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 3.17E-33 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 4.10E-52 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 1.10E-23 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 3.08E-21 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 9.52E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 7.72E-19 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 5.02E-25 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 4.83E-17 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 3.58E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 1.39E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 3.29E-76 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 1.91E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230309897 NA 1.16E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251