Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0230288040:

Variant ID: vg0230288040 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 30288040
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATACTACTACCTCCGTTTCAGGTTATAAGATTTTTTAGCATTATCCACATTCATATAGATGTTAATGAATCTAGGCACACACATATATCTTTTTTTTAAG[G/A]
AAAGATCATTATATTTAATAATGACCCGGCTTTGGTAAGAAAGCCAAGTAGATTCGTACAGGACACACACATATCTAGATTCATTAACATATATATAAAT

Reverse complement sequence

ATTTATATATATGTTAATGAATCTAGATATGTGTGTGTCCTGTACGAATCTACTTGGCTTTCTTACCAAAGCCGGGTCATTATTAAATATAATGATCTTT[C/T]
CTTAAAAAAAAGATATATGTGTGTGCCTAGATTCATTAACATCTATATGAATGTGGATAATGCTAAAAAATCTTATAACCTGAAACGGAGGTAGTAGTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.30%	13.70%	0.28%	48.69%	NA
All Indica	2759	2.80%	14.90%	0.43%	81.91%	NA
All Japonica	1512	99.10%	0.70%	0.00%	0.26%	NA
Aus	269	13.40%	82.50%	0.00%	4.09%	NA
Indica I	595	1.30%	6.20%	0.00%	92.44%	NA
Indica II	465	4.10%	2.60%	0.22%	93.12%	NA
Indica III	913	1.60%	23.70%	0.77%	73.93%	NA
Indica Intermediate	786	4.50%	18.40%	0.51%	76.59%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	1.20%	0.00%	0.83%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	64.40%	6.70%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230288040	G -> A	LOC_Os02g49550.1	downstream_gene_variant ; 4033.0bp to feature; MODIFIER	silent_mutation	Average:55.036; most accessible tissue: Callus, score: 91.844	N	N	N	N
vg0230288040	G -> A	LOC_Os02g49555.1	downstream_gene_variant ; 2522.0bp to feature; MODIFIER	silent_mutation	Average:55.036; most accessible tissue: Callus, score: 91.844	N	N	N	N
vg0230288040	G -> A	LOC_Os02g49550-LOC_Os02g49555	intergenic_region ; MODIFIER	silent_mutation	Average:55.036; most accessible tissue: Callus, score: 91.844	N	N	N	N
vg0230288040	G -> DEL	N	N	silent_mutation	Average:55.036; most accessible tissue: Callus, score: 91.844	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230288040	NA	6.79E-07	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040	NA	2.12E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040	NA	6.45E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040	3.40E-06	NA	mr1798	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040	NA	2.79E-13	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040	NA	1.73E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040	NA	9.81E-08	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040	NA	7.30E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040	NA	1.65E-07	mr1364_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040	NA	6.41E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040	NA	3.08E-16	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251