\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230288040:

Variant ID: vg0230288040 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30288040
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTACTACCTCCGTTTCAGGTTATAAGATTTTTTAGCATTATCCACATTCATATAGATGTTAATGAATCTAGGCACACACATATATCTTTTTTTTAAG[G/A]
AAAGATCATTATATTTAATAATGACCCGGCTTTGGTAAGAAAGCCAAGTAGATTCGTACAGGACACACACATATCTAGATTCATTAACATATATATAAAT

Reverse complement sequence

ATTTATATATATGTTAATGAATCTAGATATGTGTGTGTCCTGTACGAATCTACTTGGCTTTCTTACCAAAGCCGGGTCATTATTAAATATAATGATCTTT[C/T]
CTTAAAAAAAAGATATATGTGTGTGCCTAGATTCATTAACATCTATATGAATGTGGATAATGCTAAAAAATCTTATAACCTGAAACGGAGGTAGTAGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.30% 13.70% 0.28% 48.69% NA
All Indica  2759 2.80% 14.90% 0.43% 81.91% NA
All Japonica  1512 99.10% 0.70% 0.00% 0.26% NA
Aus  269 13.40% 82.50% 0.00% 4.09% NA
Indica I  595 1.30% 6.20% 0.00% 92.44% NA
Indica II  465 4.10% 2.60% 0.22% 93.12% NA
Indica III  913 1.60% 23.70% 0.77% 73.93% NA
Indica Intermediate  786 4.50% 18.40% 0.51% 76.59% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 1.20% 0.00% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 64.40% 6.70% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230288040 G -> A LOC_Os02g49550.1 downstream_gene_variant ; 4033.0bp to feature; MODIFIER silent_mutation Average:55.036; most accessible tissue: Callus, score: 91.844 N N N N
vg0230288040 G -> A LOC_Os02g49555.1 downstream_gene_variant ; 2522.0bp to feature; MODIFIER silent_mutation Average:55.036; most accessible tissue: Callus, score: 91.844 N N N N
vg0230288040 G -> A LOC_Os02g49550-LOC_Os02g49555 intergenic_region ; MODIFIER silent_mutation Average:55.036; most accessible tissue: Callus, score: 91.844 N N N N
vg0230288040 G -> DEL N N silent_mutation Average:55.036; most accessible tissue: Callus, score: 91.844 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230288040 NA 6.79E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040 NA 2.12E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040 NA 6.45E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040 3.40E-06 NA mr1798 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040 NA 2.79E-13 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040 NA 1.73E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040 NA 9.81E-08 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040 NA 7.30E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040 NA 1.65E-07 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040 NA 6.41E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230288040 NA 3.08E-16 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251