\
| Variant ID: vg0230288040 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 30288040 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 117. )
ATACTACTACCTCCGTTTCAGGTTATAAGATTTTTTAGCATTATCCACATTCATATAGATGTTAATGAATCTAGGCACACACATATATCTTTTTTTTAAG[G/A]
AAAGATCATTATATTTAATAATGACCCGGCTTTGGTAAGAAAGCCAAGTAGATTCGTACAGGACACACACATATCTAGATTCATTAACATATATATAAAT
ATTTATATATATGTTAATGAATCTAGATATGTGTGTGTCCTGTACGAATCTACTTGGCTTTCTTACCAAAGCCGGGTCATTATTAAATATAATGATCTTT[C/T]
CTTAAAAAAAAGATATATGTGTGTGCCTAGATTCATTAACATCTATATGAATGTGGATAATGCTAAAAAATCTTATAACCTGAAACGGAGGTAGTAGTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.30% | 13.70% | 0.28% | 48.69% | NA |
| All Indica | 2759 | 2.80% | 14.90% | 0.43% | 81.91% | NA |
| All Japonica | 1512 | 99.10% | 0.70% | 0.00% | 0.26% | NA |
| Aus | 269 | 13.40% | 82.50% | 0.00% | 4.09% | NA |
| Indica I | 595 | 1.30% | 6.20% | 0.00% | 92.44% | NA |
| Indica II | 465 | 4.10% | 2.60% | 0.22% | 93.12% | NA |
| Indica III | 913 | 1.60% | 23.70% | 0.77% | 73.93% | NA |
| Indica Intermediate | 786 | 4.50% | 18.40% | 0.51% | 76.59% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.20% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 64.40% | 6.70% | 1.11% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0230288040 | G -> A | LOC_Os02g49550.1 | downstream_gene_variant ; 4033.0bp to feature; MODIFIER | silent_mutation | Average:55.036; most accessible tissue: Callus, score: 91.844 | N | N | N | N |
| vg0230288040 | G -> A | LOC_Os02g49555.1 | downstream_gene_variant ; 2522.0bp to feature; MODIFIER | silent_mutation | Average:55.036; most accessible tissue: Callus, score: 91.844 | N | N | N | N |
| vg0230288040 | G -> A | LOC_Os02g49550-LOC_Os02g49555 | intergenic_region ; MODIFIER | silent_mutation | Average:55.036; most accessible tissue: Callus, score: 91.844 | N | N | N | N |
| vg0230288040 | G -> DEL | N | N | silent_mutation | Average:55.036; most accessible tissue: Callus, score: 91.844 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0230288040 | NA | 6.79E-07 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230288040 | NA | 2.12E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230288040 | NA | 6.45E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230288040 | 3.40E-06 | NA | mr1798 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230288040 | NA | 2.79E-13 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230288040 | NA | 1.73E-06 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230288040 | NA | 9.81E-08 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230288040 | NA | 7.30E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230288040 | NA | 1.65E-07 | mr1364_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230288040 | NA | 6.41E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230288040 | NA | 3.08E-16 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |