\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230170128:

Variant ID: vg0230170128 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30170128
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GTCGTTTATCGACATCATCGATGATCTCCGAGAACGGGGCTTGTCGGGATATGAAGTCGCTGCAGACTTCGTTGGTAGGCGGATCCAGCCGCTCCAGGCT[C/T]
GGGCCCATCCAGCCTATAACTATTTCGGGCCGAATGACGCGACCCGGGTTTCTCCTCGGGGTATCTTTCTCGTATTCATCTTGGCGTGCTTGTACTCGCG

Reverse complement sequence

CGCGAGTACAAGCACGCCAAGATGAATACGAGAAAGATACCCCGAGGAGAAACCCGGGTCGCGTCATTCGGCCCGAAATAGTTATAGGCTGGATGGGCCC[G/A]
AGCCTGGAGCGGCTGGATCCGCCTACCAACGAAGTCTGCAGCGACTTCATATCCCGACAAGCCCCGTTCTCGGAGATCATCGATGATGTCGATAAACGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 5.10% 0.08% 0.38% NA
All Indica  2759 97.90% 2.00% 0.00% 0.11% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 28.30% 64.70% 1.49% 5.58% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.40% 1.40% 0.00% 0.22% NA
Indica Intermediate  786 95.00% 4.80% 0.00% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230170128 C -> T LOC_Os02g49370.1 upstream_gene_variant ; 4687.0bp to feature; MODIFIER silent_mutation Average:51.808; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg0230170128 C -> T LOC_Os02g49370.2 upstream_gene_variant ; 4687.0bp to feature; MODIFIER silent_mutation Average:51.808; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg0230170128 C -> T LOC_Os02g49380.1 intron_variant ; MODIFIER silent_mutation Average:51.808; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg0230170128 C -> DEL N N silent_mutation Average:51.808; most accessible tissue: Minghui63 root, score: 69.344 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230170128 NA 7.43E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230170128 2.13E-06 4.29E-12 mr1722 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230170128 NA 9.28E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230170128 1.05E-06 NA mr1304_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230170128 NA 1.02E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230170128 5.84E-06 NA mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251