\
| Variant ID: vg0230170128 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 30170128 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )
GTCGTTTATCGACATCATCGATGATCTCCGAGAACGGGGCTTGTCGGGATATGAAGTCGCTGCAGACTTCGTTGGTAGGCGGATCCAGCCGCTCCAGGCT[C/T]
GGGCCCATCCAGCCTATAACTATTTCGGGCCGAATGACGCGACCCGGGTTTCTCCTCGGGGTATCTTTCTCGTATTCATCTTGGCGTGCTTGTACTCGCG
CGCGAGTACAAGCACGCCAAGATGAATACGAGAAAGATACCCCGAGGAGAAACCCGGGTCGCGTCATTCGGCCCGAAATAGTTATAGGCTGGATGGGCCC[G/A]
AGCCTGGAGCGGCTGGATCCGCCTACCAACGAAGTCTGCAGCGACTTCATATCCCGACAAGCCCCGTTCTCGGAGATCATCGATGATGTCGATAAACGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 5.10% | 0.08% | 0.38% | NA |
| All Indica | 2759 | 97.90% | 2.00% | 0.00% | 0.11% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 28.30% | 64.70% | 1.49% | 5.58% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.40% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 95.00% | 4.80% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0230170128 | C -> T | LOC_Os02g49370.1 | upstream_gene_variant ; 4687.0bp to feature; MODIFIER | silent_mutation | Average:51.808; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg0230170128 | C -> T | LOC_Os02g49370.2 | upstream_gene_variant ; 4687.0bp to feature; MODIFIER | silent_mutation | Average:51.808; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg0230170128 | C -> T | LOC_Os02g49380.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.808; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg0230170128 | C -> DEL | N | N | silent_mutation | Average:51.808; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0230170128 | NA | 7.43E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230170128 | 2.13E-06 | 4.29E-12 | mr1722 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230170128 | NA | 9.28E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230170128 | 1.05E-06 | NA | mr1304_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230170128 | NA | 1.02E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230170128 | 5.84E-06 | NA | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |