Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230101399:

Variant ID: vg0230101399 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 30101399
Reference Allele: G	Alternative Allele: A,GT
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGAATTCGTTTCATTTTTTGTTCCACAAAAATGTTTCACCTAGTGTATTTATAATGTTTCACTGTGTAAGGATCAAATCTTGCAGTGAACTAAAATATT[G/A,GT]
TTTTTATATAAGGTGAAACAACGCCCGATTTAAACAATTGAAACATTTCAATTTAGTGAAACAATTCCGATATACTTGTTGGAACAGTATGCAACATTTA

Reverse complement sequence

TAAATGTTGCATACTGTTCCAACAAGTATATCGGAATTGTTTCACTAAATTGAAATGTTTCAATTGTTTAAATCGGGCGTTGTTTCACCTTATATAAAAA[C/T,AC]
AATATTTTAGTTCACTGCAAGATTTGATCCTTACACAGTGAAACATTATAAATACACTAGGTGAAACATTTTTGTGGAACAAAAAATGAAACGAATTCCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.90%	36.20%	0.61%	0.00%	GT: 0.30%
All Indica	2759	97.50%	2.50%	0.07%	0.00%	NA
All Japonica	1512	0.90%	96.70%	1.52%	0.00%	GT: 0.93%
Aus	269	87.70%	12.30%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.30%	4.60%	0.13%	0.00%	NA
Temperate Japonica	767	0.40%	94.80%	3.00%	0.00%	GT: 1.83%
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	37.80%	57.80%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230101399	G -> A	LOC_Os02g49240.1	upstream_gene_variant ; 1219.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> A	LOC_Os02g49260.1	upstream_gene_variant ; 4331.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> A	LOC_Os02g49230.2	downstream_gene_variant ; 1725.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> A	LOC_Os02g49250.1	downstream_gene_variant ; 2387.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> A	LOC_Os02g49230.1	downstream_gene_variant ; 1725.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> A	LOC_Os02g49230.3	downstream_gene_variant ; 1725.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> A	LOC_Os02g49230.4	downstream_gene_variant ; 2232.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> A	LOC_Os02g49230.5	downstream_gene_variant ; 1725.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> A	LOC_Os02g49230.6	downstream_gene_variant ; 1725.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> A	LOC_Os02g49240-LOC_Os02g49250	intergenic_region ; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> GT	LOC_Os02g49240.1	upstream_gene_variant ; 1220.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> GT	LOC_Os02g49260.1	upstream_gene_variant ; 4330.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> GT	LOC_Os02g49230.2	downstream_gene_variant ; 1726.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> GT	LOC_Os02g49250.1	downstream_gene_variant ; 2386.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> GT	LOC_Os02g49230.1	downstream_gene_variant ; 1726.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> GT	LOC_Os02g49230.3	downstream_gene_variant ; 1726.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> GT	LOC_Os02g49230.4	downstream_gene_variant ; 2233.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> GT	LOC_Os02g49230.5	downstream_gene_variant ; 1726.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> GT	LOC_Os02g49230.6	downstream_gene_variant ; 1726.0bp to feature; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0230101399	G -> GT	LOC_Os02g49240-LOC_Os02g49250	intergenic_region ; MODIFIER	silent_mutation	Average:53.944; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230101399	NA	1.49E-25	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	2.03E-11	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.34E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	5.77E-15	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	4.93E-28	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.82E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	7.46E-18	mr1304	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	2.30E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	2.48E-15	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	4.68E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	5.14E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	5.55E-13	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.46E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.34E-28	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	5.14E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	4.83E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.23E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	9.64E-27	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	6.02E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	4.43E-59	mr1711	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	5.81E-28	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.79E-25	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	4.04E-114	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	3.83E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	2.39E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	3.77E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.01E-98	mr1987	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	3.32E-27	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	2.35E-32	mr1081_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.29E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.22E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	9.08E-50	mr1154_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	8.96E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.66E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	5.95E-21	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	4.60E-34	mr1256_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	6.38E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.18E-22	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.88E-24	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.12E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	3.59E-32	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.74E-47	mr1670_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	1.57E-07	3.28E-151	mr1750_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230101399	NA	1.39E-32	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251