Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0230090438:

Variant ID: vg0230090438 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 30090438
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAGTACTATTCATGTTTTATTATCTAATAGCAATAAAAATACTAATCATAAAAAGTTTCTAATAAGACAAACGGTCAAACGTTAAACGTGAATAGTG[C/T]
AAAACTGCACTTATTTTGGGACGGAGGGAGTAACTCATAAGCCCAAACAAAACAACATTAACTATGACATCAATTTATCAGTAAATTTTTTATATAGAAA

Reverse complement sequence

TTTCTATATAAAAAATTTACTGATAAATTGATGTCATAGTTAATGTTGTTTTGTTTGGGCTTATGAGTTACTCCCTCCGTCCCAAAATAAGTGCAGTTTT[G/A]
CACTATTCACGTTTAACGTTTGACCGTTTGTCTTATTAGAAACTTTTTATGATTAGTATTTTTATTGCTATTAGATAATAAAACATGAATAGTACTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	2.00%	0.42%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.04%	0.00%	NA
All Japonica	1512	92.80%	6.00%	1.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	99.50%	0.00%	0.52%	0.00%	NA
Tropical Japonica	504	79.40%	17.70%	2.98%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230090438	C -> T	LOC_Os02g49210.1	upstream_gene_variant ; 4693.0bp to feature; MODIFIER	silent_mutation	Average:53.785; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0230090438	C -> T	LOC_Os02g49220.1	upstream_gene_variant ; 2805.0bp to feature; MODIFIER	silent_mutation	Average:53.785; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0230090438	C -> T	LOC_Os02g49230.2	upstream_gene_variant ; 3854.0bp to feature; MODIFIER	silent_mutation	Average:53.785; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0230090438	C -> T	LOC_Os02g49230.1	upstream_gene_variant ; 3821.0bp to feature; MODIFIER	silent_mutation	Average:53.785; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0230090438	C -> T	LOC_Os02g49230.3	upstream_gene_variant ; 3824.0bp to feature; MODIFIER	silent_mutation	Average:53.785; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0230090438	C -> T	LOC_Os02g49230.4	upstream_gene_variant ; 3862.0bp to feature; MODIFIER	silent_mutation	Average:53.785; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0230090438	C -> T	LOC_Os02g49230.5	upstream_gene_variant ; 3862.0bp to feature; MODIFIER	silent_mutation	Average:53.785; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0230090438	C -> T	LOC_Os02g49230.6	upstream_gene_variant ; 3862.0bp to feature; MODIFIER	silent_mutation	Average:53.785; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0230090438	C -> T	LOC_Os02g49220-LOC_Os02g49230	intergenic_region ; MODIFIER	silent_mutation	Average:53.785; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230090438	NA	7.90E-06	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230090438	2.03E-06	5.97E-09	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230090438	1.52E-06	1.53E-06	mr1925_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251