\
| Variant ID: vg0230085254 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 30085254 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, A: 0.45, others allele: 0.00, population size: 107. )
GCAATCATTCACTAATTACAGTGCAGTTACAGTCGATTTGTGCCTTAGTTACATTTGTAACTTTGGTACTGCTATACTGTAACTTTAGTTCATTGCATAC[A/C]
TGATTGTGCCATTTTTGTTCTTCTTTTTATATTTTCCAGGTACTGTGCTATCAGTTCAAAAACATGGGGCTGAATGTTCAAGTGTTCCAGGTACTGTGCT
AGCACAGTACCTGGAACACTTGAACATTCAGCCCCATGTTTTTGAACTGATAGCACAGTACCTGGAAAATATAAAAAGAAGAACAAAAATGGCACAATCA[T/G]
GTATGCAATGAACTAAAGTTACAGTATAGCAGTACCAAAGTTACAAATGTAACTAAGGCACAAATCGACTGTAACTGCACTGTAATTAGTGAATGATTGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.50% | 0.70% | 16.48% | 45.39% | NA |
| All Indica | 2759 | 4.00% | 0.80% | 19.28% | 75.86% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.53% | 0.33% | NA |
| Aus | 269 | 1.90% | 3.30% | 85.87% | 8.92% | NA |
| Indica I | 595 | 2.90% | 1.00% | 10.08% | 86.05% | NA |
| Indica II | 465 | 4.70% | 0.60% | 3.87% | 90.75% | NA |
| Indica III | 913 | 3.00% | 0.30% | 31.98% | 64.73% | NA |
| Indica Intermediate | 786 | 5.70% | 1.40% | 20.61% | 72.26% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 1.19% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 66.70% | 0.00% | 8.89% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0230085254 | A -> DEL | N | N | silent_mutation | Average:14.512; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0230085254 | A -> C | LOC_Os02g49200.1 | downstream_gene_variant ; 4527.0bp to feature; MODIFIER | silent_mutation | Average:14.512; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0230085254 | A -> C | LOC_Os02g49220.1 | downstream_gene_variant ; 1839.0bp to feature; MODIFIER | silent_mutation | Average:14.512; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0230085254 | A -> C | LOC_Os02g49210.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.512; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0230085254 | NA | 3.38E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.64E-33 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.55E-45 | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.07E-11 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.58E-17 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 7.80E-27 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 8.47E-46 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.20E-51 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.11E-08 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.82E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 5.23E-27 | mr1414 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 4.99E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 2.13E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 7.00E-26 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.16E-13 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 4.03E-61 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 2.45E-115 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.19E-10 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 5.91E-21 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 6.83E-24 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 4.29E-104 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.86E-27 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.49E-35 | mr1081_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.03E-09 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 8.41E-42 | mr1092_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.93E-12 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.51E-30 | mr1105_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 4.72E-15 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 2.22E-14 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 8.79E-17 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 7.67E-16 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 6.77E-42 | mr1152_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 5.30E-52 | mr1154_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 4.32E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.12E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 4.12E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.51E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.58E-21 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 7.17E-37 | mr1256_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.64E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 2.21E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 2.25E-08 | mr1275_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 2.99E-20 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 4.81E-23 | mr1304_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.66E-26 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.58E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 7.53E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.97E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 5.26E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.54E-18 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 9.90E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.26E-48 | mr1670_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.48E-19 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 7.81E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 1.05E-33 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 3.51E-67 | mr1889_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 6.46E-64 | mr1896_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 2.23E-20 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 2.62E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230085254 | NA | 4.45E-41 | mr1944_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |