\
| Variant ID: vg0230079962 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 30079962 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, C: 0.26, others allele: 0.00, population size: 159. )
TAGAAGTACTAAAGTTACAAATGTAACTAAGGCACAAATCGACTGTAACTGCACTGTAATTAGTGAATGATTGCACTGTAAGTGGTGTAAGTGGAGACAA[C/G]
AACTAGAAAAAAAAGGGCCTACATCTACACTTATAATTTTCTGTATGATGCTGCCAGGTATACATGCTTTCTAATATTTTTCCAACACATTTTGCAGGAC
GTCCTGCAAAATGTGTTGGAAAAATATTAGAAAGCATGTATACCTGGCAGCATCATACAGAAAATTATAAGTGTAGATGTAGGCCCTTTTTTTTCTAGTT[G/C]
TTGTCTCCACTTACACCACTTACAGTGCAATCATTCACTAATTACAGTGCAGTTACAGTCGATTTGTGCCTTAGTTACATTTGTAACTTTAGTACTTCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.30% | 41.30% | 8.65% | 1.78% | NA |
| All Indica | 2759 | 17.70% | 66.60% | 12.65% | 3.01% | NA |
| All Japonica | 1512 | 91.20% | 5.50% | 3.31% | 0.00% | NA |
| Aus | 269 | 95.50% | 2.60% | 1.86% | 0.00% | NA |
| Indica I | 595 | 7.20% | 74.60% | 13.78% | 4.37% | NA |
| Indica II | 465 | 7.50% | 78.70% | 11.83% | 1.94% | NA |
| Indica III | 913 | 25.80% | 59.60% | 11.72% | 2.85% | NA |
| Indica Intermediate | 786 | 22.30% | 61.60% | 13.36% | 2.80% | NA |
| Temperate Japonica | 767 | 83.20% | 10.60% | 6.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 24.40% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0230079962 | C -> G | LOC_Os02g49210.1 | downstream_gene_variant ; 1629.0bp to feature; MODIFIER | silent_mutation | Average:12.298; most accessible tissue: Callus, score: 23.637 | N | N | N | N |
| vg0230079962 | C -> G | LOC_Os02g49200.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.298; most accessible tissue: Callus, score: 23.637 | N | N | N | N |
| vg0230079962 | C -> DEL | N | N | silent_mutation | Average:12.298; most accessible tissue: Callus, score: 23.637 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0230079962 | NA | 1.28E-16 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230079962 | 4.82E-06 | NA | mr1004_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230079962 | NA | 6.47E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230079962 | NA | 4.71E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230079962 | NA | 1.87E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230079962 | NA | 1.95E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230079962 | NA | 1.46E-23 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230079962 | NA | 1.34E-07 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |