\
| Variant ID: vg0230066458 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 30066458 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )
TCATGGTCGGTATGGCTGATCTAGCCATCCGCCGGAGGTCCGCTTCTCACATCATAGCCCTAGCTATCTCCATCCAAGGTCTGCTCTTCTGGTTGAAGAC[C/T]
CGATTGTTTCTTTCCTTCCAGATTGTCCACGCTACCAGTGTCGCAATTGTGTCAAACCCTCGGCGATGATCCTTAATCATCCTTTTGGGACTGTCATAGG
CCTATGACAGTCCCAAAAGGATGATTAAGGATCATCGCCGAGGGTTTGACACAATTGCGACACTGGTAGCGTGGACAATCTGGAAGGAAAGAAACAATCG[G/A]
GTCTTCAACCAGAAGAGCAGACCTTGGATGGAGATAGCTAGGGCTATGATGTGAGAAGCGGACCTCCGGCGGATGGCTAGATCAGCCATACCGACCATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.10% | 9.20% | 0.76% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 0.90% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 72.00% | 26.00% | 2.05% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 91.80% | 6.10% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 49.80% | 49.20% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 40.70% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0230066458 | C -> T | LOC_Os02g49170.1 | synonymous_variant ; p.Arg193Arg; LOW | synonymous_codon | Average:52.145; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0230066458 | NA | 2.75E-06 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 1.13E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 7.10E-06 | mr1185_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 4.27E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 2.50E-08 | mr1269_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 3.70E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 9.04E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 2.36E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 4.16E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 7.18E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 1.85E-09 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 2.07E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 3.59E-09 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 1.60E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 5.43E-07 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 3.64E-06 | mr1788_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0230066458 | NA | 4.81E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |