Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230033957:

Variant ID: vg0230033957 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 30033957
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCTCCCACGAGGTTGGAGAGGAGGGGAGCCGCGGGAGGTCGCCGGAGAAGAGGTGGTCGCCGGGGGGTCGCCGGTGGGGAGGGAGGAGGGAGTCAATC[C/T]
GTGGGGAAAAAGAGTGGAAAGGAGAGAGAAGGGAGTCCACGGGGTGATATATAAGGACTCCGAGATTTTCTGATATTTCCGAAAATTTTCGGATATGTCC

Reverse complement sequence

GGACATATCCGAAAATTTTCGGAAATATCAGAAAATCTCGGAGTCCTTATATATCACCCCGTGGACTCCCTTCTCTCTCCTTTCCACTCTTTTTCCCCAC[G/A]
GATTGACTCCCTCCTCCCTCCCCACCGGCGACCCCCCGGCGACCACCTCTTCTCCGGCGACCTCCCGCGGCTCCCCTCCTCTCCAACCTCGTGGGAGCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.10%	37.10%	0.80%	0.00%	NA
All Indica	2759	96.40%	3.30%	0.29%	0.00%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	86.20%	3.00%	10.78%	0.00%	NA
Indica I	595	97.50%	1.80%	0.67%	0.00%	NA
Indica II	465	94.40%	5.60%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	93.90%	5.60%	0.51%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	33.30%	65.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0230033957	C -> T	LOC_Os02g49100.1	upstream_gene_variant ; 4050.0bp to feature; MODIFIER	silent_mutation	Average:36.82; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0230033957	C -> T	LOC_Os02g49110.1	upstream_gene_variant ; 852.0bp to feature; MODIFIER	silent_mutation	Average:36.82; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0230033957	C -> T	LOC_Os02g49120.1	downstream_gene_variant ; 739.0bp to feature; MODIFIER	silent_mutation	Average:36.82; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg0230033957	C -> T	LOC_Os02g49110-LOC_Os02g49120	intergenic_region ; MODIFIER	silent_mutation	Average:36.82; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0230033957	8.64E-06	NA	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957	2.78E-06	NA	mr1023	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957	2.21E-06	NA	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957	5.87E-06	NA	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957	5.39E-06	NA	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957	7.24E-07	NA	mr1489	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957	1.72E-06	1.72E-06	mr1778	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251