\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230033957:

Variant ID: vg0230033957 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30033957
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCTCCCACGAGGTTGGAGAGGAGGGGAGCCGCGGGAGGTCGCCGGAGAAGAGGTGGTCGCCGGGGGGTCGCCGGTGGGGAGGGAGGAGGGAGTCAATC[C/T]
GTGGGGAAAAAGAGTGGAAAGGAGAGAGAAGGGAGTCCACGGGGTGATATATAAGGACTCCGAGATTTTCTGATATTTCCGAAAATTTTCGGATATGTCC

Reverse complement sequence

GGACATATCCGAAAATTTTCGGAAATATCAGAAAATCTCGGAGTCCTTATATATCACCCCGTGGACTCCCTTCTCTCTCCTTTCCACTCTTTTTCCCCAC[G/A]
GATTGACTCCCTCCTCCCTCCCCACCGGCGACCCCCCGGCGACCACCTCTTCTCCGGCGACCTCCCGCGGCTCCCCTCCTCTCCAACCTCGTGGGAGCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.10% 0.80% 0.00% NA
All Indica  2759 96.40% 3.30% 0.29% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 86.20% 3.00% 10.78% 0.00% NA
Indica I  595 97.50% 1.80% 0.67% 0.00% NA
Indica II  465 94.40% 5.60% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 93.90% 5.60% 0.51% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 33.30% 65.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230033957 C -> T LOC_Os02g49100.1 upstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:36.82; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0230033957 C -> T LOC_Os02g49110.1 upstream_gene_variant ; 852.0bp to feature; MODIFIER silent_mutation Average:36.82; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0230033957 C -> T LOC_Os02g49120.1 downstream_gene_variant ; 739.0bp to feature; MODIFIER silent_mutation Average:36.82; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0230033957 C -> T LOC_Os02g49110-LOC_Os02g49120 intergenic_region ; MODIFIER silent_mutation Average:36.82; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230033957 8.64E-06 NA mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957 2.78E-06 NA mr1023 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957 2.21E-06 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957 5.87E-06 NA mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957 5.39E-06 NA mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957 7.24E-07 NA mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230033957 1.72E-06 1.72E-06 mr1778 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251