\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0230028319:

Variant ID: vg0230028319 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 30028319
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTCCACGGCTCGGTCAGACCGCCGTCGGCTCGGTCTGACCGGTTGTGGCTCTGGCGGCTCTGTATCGCCACCAAAAACCAGACCAGTGTAACAGACCA[A/G]
TGGGGCCGGTCAAACCGGCTTTACCACGCCGGTCAGACCAACTAACAGGCTCGGTCAAACCGGCGTAAGGCCCACGGTCAGACCGCAGGTCACTTTTCAG

Reverse complement sequence

CTGAAAAGTGACCTGCGGTCTGACCGTGGGCCTTACGCCGGTTTGACCGAGCCTGTTAGTTGGTCTGACCGGCGTGGTAAAGCCGGTTTGACCGGCCCCA[T/C]
TGGTCTGTTACACTGGTCTGGTTTTTGGTGGCGATACAGAGCCGCCAGAGCCACAACCGGTCAGACCGAGCCGACGGCGGTCTGACCGAGCCGTGGACGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 34.00% 0.08% 0.00% NA
All Indica  2759 97.60% 2.40% 0.00% 0.00% NA
All Japonica  1512 3.10% 96.90% 0.00% 0.00% NA
Aus  269 88.10% 11.50% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 48.90% 47.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0230028319 A -> G LOC_Os02g49090.1 upstream_gene_variant ; 2384.0bp to feature; MODIFIER silent_mutation Average:60.36; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0230028319 A -> G LOC_Os02g49090.2 upstream_gene_variant ; 2384.0bp to feature; MODIFIER silent_mutation Average:60.36; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0230028319 A -> G LOC_Os02g49110.1 downstream_gene_variant ; 3635.0bp to feature; MODIFIER silent_mutation Average:60.36; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0230028319 A -> G LOC_Os02g49100.1 intron_variant ; MODIFIER silent_mutation Average:60.36; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0230028319 NA 2.39E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 2.68E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 1.50E-44 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 5.03E-26 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 7.12E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 9.05E-14 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 6.59E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 4.28E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 1.01E-06 4.43E-55 mr1692 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 7.02E-64 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 2.54E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 1.92E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 4.45E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 3.05E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 2.16E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 6.04E-15 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 1.27E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 3.33E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 6.20E-13 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 3.13E-52 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 5.49E-82 mr1711_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0230028319 NA 2.41E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251