Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229797766:

Variant ID: vg0229797766 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29797766
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGATTCGATAATGTCGTGCTATAGTAAACATTTGGTAATAACGGATTAATTAGGCTTAATAAATTCGTCTCGCGGTTTACAGACGGATTTTGTAATTT[A/G]
TTTTGTTATTAGACTACGTCTAATACTTCAAATGTGTGTAACAAAACTTTTCACATCTAGAGTTTCAAGGCCAAGTTTAATACTTCAAATGTGTATCCGT

Reverse complement sequence

ACGGATACACATTTGAAGTATTAAACTTGGCCTTGAAACTCTAGATGTGAAAAGTTTTGTTACACACATTTGAAGTATTAGACGTAGTCTAATAACAAAA[T/C]
AAATTACAAAATCCGTCTGTAAACCGCGAGACGAATTTATTAAGCCTAATTAATCCGTTATTACCAAATGTTTACTATAGCACGACATTATCGAATCATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 22.20% 0.13% 0.00% NA
All Indica  2759 72.40% 27.40% 0.22% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 77.10% 22.90% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 55.80% 43.80% 0.44% 0.00% NA
Indica Intermediate  786 73.40% 26.30% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229797766 A -> G LOC_Os02g48660.1 upstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:82.388; most accessible tissue: Minghui63 panicle, score: 92.928 N N N N
vg0229797766 A -> G LOC_Os02g48680.1 upstream_gene_variant ; 2953.0bp to feature; MODIFIER silent_mutation Average:82.388; most accessible tissue: Minghui63 panicle, score: 92.928 N N N N
vg0229797766 A -> G LOC_Os02g48650.1 downstream_gene_variant ; 2347.0bp to feature; MODIFIER silent_mutation Average:82.388; most accessible tissue: Minghui63 panicle, score: 92.928 N N N N
vg0229797766 A -> G LOC_Os02g48670.1 downstream_gene_variant ; 1685.0bp to feature; MODIFIER silent_mutation Average:82.388; most accessible tissue: Minghui63 panicle, score: 92.928 N N N N
vg0229797766 A -> G LOC_Os02g48660-LOC_Os02g48670 intergenic_region ; MODIFIER silent_mutation Average:82.388; most accessible tissue: Minghui63 panicle, score: 92.928 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0229797766 A G -0.01 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229797766 NA 5.11E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229797766 NA 1.67E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 NA 2.90E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 NA 4.84E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 NA 4.83E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 NA 5.80E-14 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 NA 9.66E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 NA 3.44E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 5.03E-06 5.03E-06 mr1342_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 NA 8.92E-10 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 NA 3.84E-07 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 NA 5.24E-09 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229797766 NA 3.23E-06 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251