\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229736003:

Variant ID: vg0229736003 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29736003
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCGCCGCCGCTGTGGTCTCCTTCGTCTTCGTCACGGTGGAGCTCAGCCCGGGTGCCGCCGCCGCTCGCAGGTCGCCCCACCATCTCCGCCTGCTGCGG[A/G]
GGAGAGAGAGAGGGGGAGAGGGAACGGCGAGGAGAGAGAGGGAACTGAGGGAGGGGAGAGAGAAGGGACACGTGGGTCCCACAATCTATTTTCTGTGTCA

Reverse complement sequence

TGACACAGAAAATAGATTGTGGGACCCACGTGTCCCTTCTCTCTCCCCTCCCTCAGTTCCCTCTCTCTCCTCGCCGTTCCCTCTCCCCCTCTCTCTCTCC[T/C]
CCGCAGCAGGCGGAGATGGTGGGGCGACCTGCGAGCGGCGGCGGCACCCGGGCTGAGCTCCACCGTGACGAAGACGAAGGAGACCACAGCGGCGGCGGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 33.90% 1.93% 0.00% NA
All Indica  2759 67.70% 30.30% 1.99% 0.00% NA
All Japonica  1512 73.60% 24.20% 2.18% 0.00% NA
Aus  269 1.90% 97.80% 0.37% 0.00% NA
Indica I  595 75.80% 21.20% 3.03% 0.00% NA
Indica II  465 92.70% 4.50% 2.80% 0.00% NA
Indica III  913 49.10% 50.40% 0.55% 0.00% NA
Indica Intermediate  786 68.30% 29.30% 2.42% 0.00% NA
Temperate Japonica  767 68.70% 27.90% 3.39% 0.00% NA
Tropical Japonica  504 75.20% 23.80% 0.99% 0.00% NA
Japonica Intermediate  241 85.90% 13.30% 0.83% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 46.70% 51.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229736003 A -> G LOC_Os02g48570.1 downstream_gene_variant ; 160.0bp to feature; MODIFIER silent_mutation Average:78.322; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg0229736003 A -> G LOC_Os02g48570.2 downstream_gene_variant ; 160.0bp to feature; MODIFIER silent_mutation Average:78.322; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg0229736003 A -> G LOC_Os02g48560-LOC_Os02g48570 intergenic_region ; MODIFIER silent_mutation Average:78.322; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0229736003 A G -0.04 -0.04 -0.04 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229736003 NA 2.22E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 1.08E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 1.24E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 9.25E-10 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 1.16E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 4.28E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 1.17E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 3.68E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 4.49E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 9.91E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 7.15E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 3.51E-07 NA mr1711_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 5.21E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 3.83E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 1.80E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 2.45E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229736003 NA 9.77E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251