\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229667121:

Variant ID: vg0229667121 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29667121
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTAAATGCAATAATATTACACGTCAAACGAAGGGGCTATGATAACATGATGATCAATTTAAAAAATTCAATTTGTGTTAAATGATGATCAATATGAAAC[G/A]
GATGGAGTATTTCATAGGCAAAGCCGCGTCTATTTTTTAGTTCTTTCTTTCCCATGGTGCTTCTTTTTTTCAAGACATTTCTCTTTCTCTATATTCTTTT

Reverse complement sequence

AAAAGAATATAGAGAAAGAGAAATGTCTTGAAAAAAAGAAGCACCATGGGAAAGAAAGAACTAAAAAATAGACGCGGCTTTGCCTATGAAATACTCCATC[C/T]
GTTTCATATTGATCATCATTTAACACAAATTGAATTTTTTAAATTGATCATCATGTTATCATAGCCCCTTCGTTTGACGTGTAATATTATTGCATTTAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 8.00% 0.15% 0.00% NA
All Indica  2759 91.20% 8.70% 0.11% 0.00% NA
All Japonica  1512 97.40% 2.40% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 88.60% 11.30% 0.17% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 87.20% 12.60% 0.22% 0.00% NA
Indica Intermediate  786 94.30% 5.70% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 93.70% 5.80% 0.60% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229667121 G -> A LOC_Os02g48440.1 upstream_gene_variant ; 2658.0bp to feature; MODIFIER silent_mutation Average:34.269; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0229667121 G -> A LOC_Os02g48450.1 upstream_gene_variant ; 622.0bp to feature; MODIFIER silent_mutation Average:34.269; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0229667121 G -> A LOC_Os02g48460.1 upstream_gene_variant ; 3645.0bp to feature; MODIFIER silent_mutation Average:34.269; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0229667121 G -> A LOC_Os02g48440-LOC_Os02g48450 intergenic_region ; MODIFIER silent_mutation Average:34.269; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229667121 3.68E-06 NA mr1798 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251