Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229667121:

Variant ID: vg0229667121 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 29667121
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTAAATGCAATAATATTACACGTCAAACGAAGGGGCTATGATAACATGATGATCAATTTAAAAAATTCAATTTGTGTTAAATGATGATCAATATGAAAC[G/A]
GATGGAGTATTTCATAGGCAAAGCCGCGTCTATTTTTTAGTTCTTTCTTTCCCATGGTGCTTCTTTTTTTCAAGACATTTCTCTTTCTCTATATTCTTTT

Reverse complement sequence

AAAAGAATATAGAGAAAGAGAAATGTCTTGAAAAAAAGAAGCACCATGGGAAAGAAAGAACTAAAAAATAGACGCGGCTTTGCCTATGAAATACTCCATC[C/T]
GTTTCATATTGATCATCATTTAACACAAATTGAATTTTTTAAATTGATCATCATGTTATCATAGCCCCTTCGTTTGACGTGTAATATTATTGCATTTAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.90%	8.00%	0.15%	0.00%	NA
All Indica	2759	91.20%	8.70%	0.11%	0.00%	NA
All Japonica	1512	97.40%	2.40%	0.20%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	88.60%	11.30%	0.17%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	87.20%	12.60%	0.22%	0.00%	NA
Indica Intermediate	786	94.30%	5.70%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	93.70%	5.80%	0.60%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0229667121	G -> A	LOC_Os02g48440.1	upstream_gene_variant ; 2658.0bp to feature; MODIFIER	silent_mutation	Average:34.269; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0229667121	G -> A	LOC_Os02g48450.1	upstream_gene_variant ; 622.0bp to feature; MODIFIER	silent_mutation	Average:34.269; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0229667121	G -> A	LOC_Os02g48460.1	upstream_gene_variant ; 3645.0bp to feature; MODIFIER	silent_mutation	Average:34.269; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0229667121	G -> A	LOC_Os02g48440-LOC_Os02g48450	intergenic_region ; MODIFIER	silent_mutation	Average:34.269; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0229667121	3.68E-06	NA	mr1798	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251