\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229574749:

Variant ID: vg0229574749 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29574749
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


ATACACCCGGGCAAGTACAAGCAATCCGCATAAGATAATACTACACGGGACCTGCATACTCCCTCCGTCAAAAAAAAAATAAAAAAAGACAAAACCTGGT[C/T]
TCCGTGTCCAACTTTAACTGGCCGTCTTATATAATTTTTTTTATAATTCGTATTTTTATTGTTGTTAGATGATAAAACATAATTAATATTTTATACGTGA

Reverse complement sequence

TCACGTATAAAATATTAATTATGTTTTATCATCTAACAACAATAAAAATACGAATTATAAAAAAAATTATATAAGACGGCCAGTTAAAGTTGGACACGGA[G/A]
ACCAGGTTTTGTCTTTTTTTATTTTTTTTTTGACGGAGGGAGTATGCAGGTCCCGTGTAGTATTATCTTATGCGGATTGCTTGTACTTGCCCGGGTGTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 40.90% 0.51% 0.66% NA
All Indica  2759 91.80% 6.30% 0.76% 1.12% NA
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 58.00% 41.60% 0.37% 0.00% NA
Indica I  595 90.90% 5.00% 2.18% 1.85% NA
Indica II  465 95.30% 2.60% 0.22% 1.94% NA
Indica III  913 93.40% 5.90% 0.00% 0.66% NA
Indica Intermediate  786 88.50% 9.90% 0.89% 0.64% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 2.20% 97.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 37.80% 60.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229574749 C -> T LOC_Os02g48320.1 upstream_gene_variant ; 1207.0bp to feature; MODIFIER silent_mutation Average:77.485; most accessible tissue: Callus, score: 99.046 N N N N
vg0229574749 C -> T LOC_Os02g48320.3 upstream_gene_variant ; 1048.0bp to feature; MODIFIER silent_mutation Average:77.485; most accessible tissue: Callus, score: 99.046 N N N N
vg0229574749 C -> T LOC_Os02g48320.2 upstream_gene_variant ; 491.0bp to feature; MODIFIER silent_mutation Average:77.485; most accessible tissue: Callus, score: 99.046 N N N N
vg0229574749 C -> T LOC_Os02g48320-LOC_Os02g48330 intergenic_region ; MODIFIER silent_mutation Average:77.485; most accessible tissue: Callus, score: 99.046 N N N N
vg0229574749 C -> DEL N N silent_mutation Average:77.485; most accessible tissue: Callus, score: 99.046 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0229574749 C T -0.05 0.01 0.0 0.0 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229574749 NA 1.07E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 7.77E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 5.92E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 4.82E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 1.13E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 7.06E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 2.70E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 4.93E-14 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 5.09E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 2.36E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 8.05E-21 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 1.55E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 1.58E-12 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 9.99E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 3.64E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 3.97E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 1.77E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 1.29E-28 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 2.97E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 1.14E-08 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 2.08E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 7.65E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229574749 NA 6.88E-28 mr1708_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251