Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229569578:

Variant ID: vg0229569578 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 29569578
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

GTATCGTACATGCACTTCCGGAGGTTGAAGACGATAGGGCTGAAAAGGAAGAAAATAATGGGCTTTCGGTCCAAAACCAAATAAGGAGTATAATGTATAG[G/A]
CGATAAAAAATATTTTTACCCATTGCAACGCATGGGCATTTTTTCTAGTAAAAGAAAAGAGACTAGCTTCAGCAACCATGAAATCCCAAGCTAGTTCTTA

Reverse complement sequence

TAAGAACTAGCTTGGGATTTCATGGTTGCTGAAGCTAGTCTCTTTTCTTTTACTAGAAAAAATGCCCATGCGTTGCAATGGGTAAAAATATTTTTTATCG[C/T]
CTATACATTATACTCCTTATTTGGTTTTGGACCGAAAGCCCATTATTTTCTTCCTTTTCAGCCCTATCGTCTTCAACCTCCGGAAGTGCATGTACGATAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.30%	1.70%	0.00%	0.00%	NA
All Indica	2759	97.10%	2.90%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	86.90%	13.10%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.30%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0229569578	G -> A	LOC_Os02g48320.1	downstream_gene_variant ; 2161.0bp to feature; MODIFIER	silent_mutation	Average:42.834; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg0229569578	G -> A	LOC_Os02g48320.3	downstream_gene_variant ; 2161.0bp to feature; MODIFIER	silent_mutation	Average:42.834; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg0229569578	G -> A	LOC_Os02g48320.2	downstream_gene_variant ; 2161.0bp to feature; MODIFIER	silent_mutation	Average:42.834; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg0229569578	G -> A	LOC_Os02g48300-LOC_Os02g48320	intergenic_region ; MODIFIER	silent_mutation	Average:42.834; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0229569578	NA	6.17E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	2.58E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	3.13E-07	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	1.44E-18	mr1498	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	2.43E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	1.66E-15	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	2.09E-08	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	4.16E-10	mr1925	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	9.26E-14	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	3.76E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	1.20E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	1.70E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	3.45E-15	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	3.35E-15	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	1.63E-09	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229569578	NA	3.34E-12	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251