\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229534325:

Variant ID: vg0229534325 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29534325
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTGGAAAATTTGTCCACGACTACCATGATTGTGTCATATTTGCCTGACTTAGGCAGTCCCTCTATGAAGTCCATACTGACAGTCATCCAAGCTTGCA[T/C]
AGGGACTGGCAATGGTTGCAACAGACCTGGAGACTTGCAGTGTTCAACTTTGGCCTGCTGACAAGTAGTACACTGAGCAACATATTGCTGCACATCCTTT

Reverse complement sequence

AAAGGATGTGCAGCAATATGTTGCTCAGTGTACTACTTGTCAGCAGGCCAAAGTTGAACACTGCAAGTCTCCAGGTCTGTTGCAACCATTGCCAGTCCCT[A/G]
TGCAAGCTTGGATGACTGTCAGTATGGACTTCATAGAGGGACTGCCTAAGTCAGGCAAATATGACACAATCATGGTAGTCGTGGACAAATTTTCCAAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.40% 8.50% 1.25% 58.89% NA
All Indica  2759 4.30% 1.10% 1.41% 93.19% NA
All Japonica  1512 81.20% 16.00% 1.12% 1.72% NA
Aus  269 35.30% 6.30% 0.74% 57.62% NA
Indica I  595 2.40% 0.00% 0.67% 96.97% NA
Indica II  465 4.70% 0.20% 1.72% 93.33% NA
Indica III  913 1.90% 1.10% 1.53% 95.51% NA
Indica Intermediate  786 8.40% 2.40% 1.65% 87.53% NA
Temperate Japonica  767 96.70% 1.30% 1.30% 0.65% NA
Tropical Japonica  504 53.60% 42.10% 1.19% 3.17% NA
Japonica Intermediate  241 89.20% 8.30% 0.41% 2.07% NA
VI/Aromatic  96 8.30% 89.60% 0.00% 2.08% NA
Intermediate  90 38.90% 27.80% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229534325 T -> DEL LOC_Os02g48240.1 N frameshift_variant Average:11.924; most accessible tissue: Callus, score: 74.859 N N N N
vg0229534325 T -> C LOC_Os02g48240.1 missense_variant ; p.Met127Val; MODERATE nonsynonymous_codon ; M127V Average:11.924; most accessible tissue: Callus, score: 74.859 benign -0.458 TOLERATED 0.28

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229534325 NA 1.02E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229534325 NA 5.11E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229534325 NA 1.86E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229534325 NA 2.28E-12 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229534325 NA 1.57E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229534325 NA 4.69E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229534325 NA 1.47E-13 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229534325 4.86E-06 1.33E-15 mr1178_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229534325 NA 2.44E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251