\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229470684:

Variant ID: vg0229470684 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29470684
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTTAATGGATGATGATGTGGTATCTTTTCATGTTATGCTTTAGGATTTAGTGGACTTTATAGTAAGAGAGGATAGGTTGTTTCCGCTGCATAATTTTC[C/T]
GAGTTATGTTGGGATTAAGATCCTCTAACTTACTTCTCTCTAACTGATGTCATTGATATGTGGGCCCTCTATATAGTAGGCTCATATGTCAGTGACTCAA

Reverse complement sequence

TTGAGTCACTGACATATGAGCCTACTATATAGAGGGCCCACATATCAATGACATCAGTTAGAGAGAAGTAAGTTAGAGGATCTTAATCCCAACATAACTC[G/A]
GAAAATTATGCAGCGGAAACAACCTATCCTCTCTTACTATAAAGTCCACTAAATCCTAAAGCATAACATGAAAAGATACCACATCATCATCCATTAACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 21.30% 0.25% 0.00% NA
All Indica  2759 97.20% 2.60% 0.11% 0.00% NA
All Japonica  1512 56.60% 43.10% 0.33% 0.00% NA
Aus  269 41.60% 57.20% 1.12% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.60% 2.30% 0.11% 0.00% NA
Indica Intermediate  786 93.50% 6.40% 0.13% 0.00% NA
Temperate Japonica  767 73.30% 26.20% 0.52% 0.00% NA
Tropical Japonica  504 26.20% 73.60% 0.20% 0.00% NA
Japonica Intermediate  241 67.20% 32.80% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 96.90% 1.04% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229470684 C -> T LOC_Os02g48130.1 downstream_gene_variant ; 2611.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 82.996 N N N N
vg0229470684 C -> T LOC_Os02g48140.1 downstream_gene_variant ; 1443.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 82.996 N N N N
vg0229470684 C -> T LOC_Os02g48150.1 downstream_gene_variant ; 733.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 82.996 N N N N
vg0229470684 C -> T LOC_Os02g48160.1 downstream_gene_variant ; 4242.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 82.996 N N N N
vg0229470684 C -> T LOC_Os02g48140.2 downstream_gene_variant ; 1443.0bp to feature; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 82.996 N N N N
vg0229470684 C -> T LOC_Os02g48140-LOC_Os02g48150 intergenic_region ; MODIFIER silent_mutation Average:55.155; most accessible tissue: Callus, score: 82.996 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229470684 NA 1.10E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 NA 8.11E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 8.14E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 NA 5.64E-11 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 NA 2.80E-09 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 2.73E-07 NA mr1585 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 NA 1.19E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 3.11E-06 NA mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 NA 6.39E-11 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 NA 2.40E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 NA 6.02E-10 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 NA 1.61E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 7.39E-09 NA mr1585_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 8.13E-07 NA mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 NA 2.03E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684 NA 2.84E-11 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251