Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229470684:

Variant ID: vg0229470684 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 29470684
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTTAATGGATGATGATGTGGTATCTTTTCATGTTATGCTTTAGGATTTAGTGGACTTTATAGTAAGAGAGGATAGGTTGTTTCCGCTGCATAATTTTC[C/T]
GAGTTATGTTGGGATTAAGATCCTCTAACTTACTTCTCTCTAACTGATGTCATTGATATGTGGGCCCTCTATATAGTAGGCTCATATGTCAGTGACTCAA

Reverse complement sequence

TTGAGTCACTGACATATGAGCCTACTATATAGAGGGCCCACATATCAATGACATCAGTTAGAGAGAAGTAAGTTAGAGGATCTTAATCCCAACATAACTC[G/A]
GAAAATTATGCAGCGGAAACAACCTATCCTCTCTTACTATAAAGTCCACTAAATCCTAAAGCATAACATGAAAAGATACCACATCATCATCCATTAACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.40%	21.30%	0.25%	0.00%	NA
All Indica	2759	97.20%	2.60%	0.11%	0.00%	NA
All Japonica	1512	56.60%	43.10%	0.33%	0.00%	NA
Aus	269	41.60%	57.20%	1.12%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	97.60%	2.30%	0.11%	0.00%	NA
Indica Intermediate	786	93.50%	6.40%	0.13%	0.00%	NA
Temperate Japonica	767	73.30%	26.20%	0.52%	0.00%	NA
Tropical Japonica	504	26.20%	73.60%	0.20%	0.00%	NA
Japonica Intermediate	241	67.20%	32.80%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	96.90%	1.04%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0229470684	C -> T	LOC_Os02g48130.1	downstream_gene_variant ; 2611.0bp to feature; MODIFIER	silent_mutation	Average:55.155; most accessible tissue: Callus, score: 82.996	N	N	N	N
vg0229470684	C -> T	LOC_Os02g48140.1	downstream_gene_variant ; 1443.0bp to feature; MODIFIER	silent_mutation	Average:55.155; most accessible tissue: Callus, score: 82.996	N	N	N	N
vg0229470684	C -> T	LOC_Os02g48150.1	downstream_gene_variant ; 733.0bp to feature; MODIFIER	silent_mutation	Average:55.155; most accessible tissue: Callus, score: 82.996	N	N	N	N
vg0229470684	C -> T	LOC_Os02g48160.1	downstream_gene_variant ; 4242.0bp to feature; MODIFIER	silent_mutation	Average:55.155; most accessible tissue: Callus, score: 82.996	N	N	N	N
vg0229470684	C -> T	LOC_Os02g48140.2	downstream_gene_variant ; 1443.0bp to feature; MODIFIER	silent_mutation	Average:55.155; most accessible tissue: Callus, score: 82.996	N	N	N	N
vg0229470684	C -> T	LOC_Os02g48140-LOC_Os02g48150	intergenic_region ; MODIFIER	silent_mutation	Average:55.155; most accessible tissue: Callus, score: 82.996	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0229470684	NA	1.10E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	NA	8.11E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	8.14E-06	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	NA	5.64E-11	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	NA	2.80E-09	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	2.73E-07	NA	mr1585	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	NA	1.19E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	3.11E-06	NA	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	NA	6.39E-11	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	NA	2.40E-07	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	NA	6.02E-10	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	NA	1.61E-06	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	7.39E-09	NA	mr1585_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	8.13E-07	NA	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	NA	2.03E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229470684	NA	2.84E-11	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251