| Variant ID: vg0229400708 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 29400708 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 241. )
CGTACAAAATGCTAGCTAGTCATTGTTACTCTCTCTATCCCAAAAATAATCAACCTAGTAGAAAGAATCAGTGTTGAATCTTTTTCATCCTTTGACCTAA[C/T]
AATGGGTACCGTATTACTGGCTGATGTCTAATCGCATAAAACACTAGTCTTTGTTAGAAAGAATCAGTGTTGAATCCTTTGACCTAACAATGGGTACCGT
ACGGTACCCATTGTTAGGTCAAAGGATTCAACACTGATTCTTTCTAACAAAGACTAGTGTTTTATGCGATTAGACATCAGCCAGTAATACGGTACCCATT[G/A]
TTAGGTCAAAGGATGAAAAAGATTCAACACTGATTCTTTCTACTAGGTTGATTATTTTTGGGATAGAGAGAGTAACAATGACTAGCTAGCATTTTGTACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.10% | 28.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 51.50% | 48.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 14.30% | 85.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 68.40% | 31.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 64.30% | 35.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 55.00% | 44.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0229400708 | C -> T | LOC_Os02g48020.1 | upstream_gene_variant ; 4091.0bp to feature; MODIFIER | silent_mutation | Average:41.679; most accessible tissue: Callus, score: 69.287 | N | N | N | N |
| vg0229400708 | C -> T | LOC_Os02g48040.1 | downstream_gene_variant ; 4555.0bp to feature; MODIFIER | silent_mutation | Average:41.679; most accessible tissue: Callus, score: 69.287 | N | N | N | N |
| vg0229400708 | C -> T | LOC_Os02g48030.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.679; most accessible tissue: Callus, score: 69.287 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0229400708 | NA | 7.41E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229400708 | NA | 9.23E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229400708 | NA | 1.31E-18 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229400708 | NA | 7.58E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229400708 | NA | 2.28E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229400708 | NA | 3.81E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229400708 | NA | 3.32E-16 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229400708 | NA | 3.48E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229400708 | NA | 5.94E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229400708 | NA | 6.06E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/