\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229389860:

Variant ID: vg0229389860 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29389860
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GATCCTCCGCCCCTAGTCGTTTATCTGTTAATAGATTTGAACCCTACTTGTACATATGTGAGTGCATTTTATTATCATCGGTATTGTGTGTATTGCCCGT[A/G]
TGTGATGATGTGTATCAGCATATGTAATCAGAGAAAACAATCTATTATACACTAGTATAGTCGATTTTGTGTGATGGTCTTCTCTCCTCTCGAAGATAAA

Reverse complement sequence

TTTATCTTCGAGAGGAGAGAAGACCATCACACAAAATCGACTATACTAGTGTATAATAGATTGTTTTCTCTGATTACATATGCTGATACACATCATCACA[T/C]
ACGGGCAATACACACAATACCGATGATAATAAAATGCACTCACATATGTACAAGTAGGGTTCAAATCTATTAACAGATAAACGACTAGGGGCGGAGGATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.30% 2.20% 0.49% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 91.90% 6.80% 1.32% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 85.50% 11.90% 2.61% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229389860 A -> G LOC_Os02g48010.1 upstream_gene_variant ; 1301.0bp to feature; MODIFIER silent_mutation Average:65.4; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0229389860 A -> G LOC_Os02g48010-LOC_Os02g48020 intergenic_region ; MODIFIER silent_mutation Average:65.4; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229389860 2.80E-06 2.80E-06 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 1.48E-06 1.02E-10 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 9.59E-08 9.74E-12 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 6.03E-06 1.90E-07 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 6.34E-06 6.34E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 NA 3.50E-08 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 1.94E-06 1.84E-12 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 9.47E-08 4.77E-12 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 1.83E-06 2.08E-09 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 4.79E-06 4.79E-06 mr1992 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 1.07E-09 2.95E-14 mr1305_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 NA 7.34E-08 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 NA 5.97E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 3.13E-09 2.75E-17 mr1585_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 NA 2.37E-07 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229389860 NA 3.21E-08 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251