RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0229359655:

Variant ID: vg0229359655 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 29359655
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTAATGTTTTAATTTTATTAATAGACCATTTCTAAAAGTATTTTCAAGAAATGAATCTTTCTTTTGGTGCCCAAATAACTCTCACGCCACACGCAGCC[G/A]
GTGTCTGCCACGCACTGTAGCTGGCATGGCCAAACCACCCTGCCACTGCCAGGCAGGCGTGGCCAAAAGGTTTATTTCTTAAAAATACTTTTAGAAAGTC

Reverse complement sequence

GACTTTCTAAAAGTATTTTTAAGAAATAAACCTTTTGGCCACGCCTGCCTGGCAGTGGCAGGGTGGTTTGGCCATGCCAGCTACAGTGCGTGGCAGACAC[C/T]
GGCTGCGTGTGGCGTGAGAGTTATTTGGGCACCAAAAGAAAGATTCATTTCTTGAAAATACTTTTAGAAATGGTCTATTAATAAAATTAAAACATTAAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.90%	18.00%	0.11%	0.00%	NA
All Indica	2759	69.60%	30.20%	0.18%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	80.20%	19.50%	0.34%	0.00%	NA
Indica II	465	56.60%	43.20%	0.22%	0.00%	NA
Indica III	913	63.70%	36.10%	0.11%	0.00%	NA
Indica Intermediate	786	76.10%	23.80%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0229359655	G -> A	LOC_Os02g47980.1	upstream_gene_variant ; 4432.0bp to feature; MODIFIER	silent_mutation	Average:58.979; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0229359655	G -> A	LOC_Os02g47970.1	downstream_gene_variant ; 1764.0bp to feature; MODIFIER	silent_mutation	Average:58.979; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0229359655	G -> A	LOC_Os02g47970-LOC_Os02g47980	intergenic_region ; MODIFIER	silent_mutation	Average:58.979; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0229359655	3.72E-07	NA	mr1156_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229359655	2.66E-06	8.98E-07	mr1156_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229359655	NA	1.13E-06	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229359655	NA	6.79E-06	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0229359655:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact