\
| Variant ID: vg0229312349 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 29312349 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 236. )
ACGCCTCGAGGCACCTCGTCGCACTCTACTTTTGACTGATGTTACCGGAGGCAGGTTCCTCGCCACCAGCGGCACCTGCCTCATAGCGGTGGTGAAAAAA[T/G]
AAATCCTAGATAGCCTTATCATCAATAGTGTCTAGAGATGGATCTAGACCCCTGGTATCCAAACCATGGCCTGGGGCCTGAGGTTCAGAAACCCACAAAT
ATTTGTGGGTTTCTGAACCTCAGGCCCCAGGCCATGGTTTGGATACCAGGGGTCTAGATCCATCTCTAGACACTATTGATGATAAGGCTATCTAGGATTT[A/C]
TTTTTTCACCACCGCTATGAGGCAGGTGCCGCTGGTGGCGAGGAACCTGCCTCCGGTAACATCAGTCAAAAGTAGAGTGCGACGAGGTGCCTCGAGGCGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.70% | 43.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 94.30% | 5.50% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 5.90% | 94.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.00% | 2.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.90% | 12.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 62.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0229312349 | T -> G | LOC_Os02g47910.1 | downstream_gene_variant ; 1180.0bp to feature; MODIFIER | silent_mutation | Average:59.308; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0229312349 | T -> G | LOC_Os02g47910-LOC_Os02g47920 | intergenic_region ; MODIFIER | silent_mutation | Average:59.308; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0229312349 | NA | 9.62E-26 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 1.31E-14 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 1.50E-29 | mr1208 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 3.13E-15 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 8.79E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 7.83E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 1.89E-41 | mr1721 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 4.37E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 3.63E-28 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 6.83E-37 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 2.61E-15 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 2.57E-21 | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | 2.19E-07 | NA | mr1546_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 1.16E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0229312349 | NA | 1.69E-38 | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |