\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229268619:

Variant ID: vg0229268619 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29268619
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TATCTTTCCAACCAATCATAACTCTTCACCATTTACTTTTCTCACCTACCTCCACTAATCATCTAATCACAATCCTCCACCACTCACTTTTACCTACTTT[C/T,A]
TTAATAACCATATCCAACTCTAAAACTTCTTATATTCTGGAACAGAGTAAGTACTCTTTACTGGGCCCGTTCAGCTACCAGGGCTGCAGTTACGCAACAG

Reverse complement sequence

CTGTTGCGTAACTGCAGCCCTGGTAGCTGAACGGGCCCAGTAAAGAGTACTTACTCTGTTCCAGAATATAAGAAGTTTTAGAGTTGGATATGGTTATTAA[G/A,T]
AAAGTAGGTAAAAGTGAGTGGTGGAGGATTGTGATTAGATGATTAGTGGAGGTAGGTGAGAAAAGTAAATGGTGAAGAGTTATGATTGGTTGGAAAGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 33.90% 0.53% 13.65% A: 0.04%
All Indica  2759 64.00% 12.00% 0.80% 23.20% NA
All Japonica  1512 41.40% 58.60% 0.00% 0.00% NA
Aus  269 6.30% 93.70% 0.00% 0.00% NA
Indica I  595 89.90% 0.80% 0.50% 8.74% NA
Indica II  465 56.60% 6.90% 0.43% 36.13% NA
Indica III  913 56.30% 17.60% 0.33% 25.74% NA
Indica Intermediate  786 57.80% 16.90% 1.78% 23.54% NA
Temperate Japonica  767 72.60% 27.40% 0.00% 0.00% NA
Tropical Japonica  504 2.20% 97.80% 0.00% 0.00% NA
Japonica Intermediate  241 24.10% 75.90% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 44.40% 44.40% 3.33% 5.56% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229268619 C -> A LOC_Os02g47840.1 upstream_gene_variant ; 3122.0bp to feature; MODIFIER silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0229268619 C -> A LOC_Os02g47850.1 upstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0229268619 C -> A LOC_Os02g47850.2 upstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0229268619 C -> A LOC_Os02g47850.3 upstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0229268619 C -> A LOC_Os02g47840-LOC_Os02g47850 intergenic_region ; MODIFIER silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0229268619 C -> T LOC_Os02g47840.1 upstream_gene_variant ; 3122.0bp to feature; MODIFIER silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0229268619 C -> T LOC_Os02g47850.1 upstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0229268619 C -> T LOC_Os02g47850.2 upstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0229268619 C -> T LOC_Os02g47850.3 upstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0229268619 C -> T LOC_Os02g47840-LOC_Os02g47850 intergenic_region ; MODIFIER silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0229268619 C -> DEL N N silent_mutation Average:78.235; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0229268619 C A 0.02 0.0 0.0 0.0 -0.01 -0.02
vg0229268619 C T 0.02 0.0 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229268619 NA 1.27E-16 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229268619 NA 6.99E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229268619 NA 8.00E-17 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 1.24E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 2.08E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 4.12E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 2.58E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 1.81E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 2.70E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 2.69E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 2.08E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 6.17E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 1.94E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 1.04E-06 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 1.21E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 3.53E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 7.39E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 2.94E-10 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 6.53E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 1.10E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 3.70E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 2.82E-40 mr1580_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 5.49E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 2.34E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 1.57E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 1.58E-38 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 5.98E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 8.74E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 8.01E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229268619 NA 3.02E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251