\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0229153698:

Variant ID: vg0229153698 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 29153698
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTTTAGCTAATTGTGACATCAAGCTATCAATCATGGTTCGAATATTTAATACCTAATTTGTAATTTGTAATAGAAATTAATATTTGACTTATCTATCT[T/A]
GTGCATAATTATTTGTAGGATTAAATATATTCTCGTAAATCATATCTATTGCTTAAATGTAGTTCTTTTCTTTACCTTCTTGGTGATCATTTATGGTTTG

Reverse complement sequence

CAAACCATAAATGATCACCAAGAAGGTAAAGAAAAGAACTACATTTAAGCAATAGATATGATTTACGAGAATATATTTAATCCTACAAATAATTATGCAC[A/T]
AGATAGATAAGTCAAATATTAATTTCTATTACAAATTACAAATTAGGTATTAAATATTCGAACCATGATTGATAGCTTGATGTCACAATTAGCTAAAGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.80% 29.60% 2.50% 24.16% NA
All Indica  2759 51.60% 5.30% 2.61% 40.56% NA
All Japonica  1512 39.40% 57.90% 2.45% 0.33% NA
Aus  269 7.40% 89.60% 2.23% 0.74% NA
Indica I  595 27.70% 1.70% 2.02% 68.57% NA
Indica II  465 50.10% 2.40% 2.80% 44.73% NA
Indica III  913 73.60% 3.60% 2.19% 20.59% NA
Indica Intermediate  786 44.90% 11.60% 3.44% 40.08% NA
Temperate Japonica  767 69.50% 27.00% 3.26% 0.26% NA
Tropical Japonica  504 1.40% 97.00% 0.99% 0.60% NA
Japonica Intermediate  241 22.80% 74.30% 2.90% 0.00% NA
VI/Aromatic  96 2.10% 96.90% 0.00% 1.04% NA
Intermediate  90 31.10% 48.90% 3.33% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0229153698 T -> A LOC_Os02g47680.1 upstream_gene_variant ; 4110.0bp to feature; MODIFIER silent_mutation Average:5.587; most accessible tissue: Callus, score: 9.519 N N N N
vg0229153698 T -> A LOC_Os02g47690.1 upstream_gene_variant ; 2634.0bp to feature; MODIFIER silent_mutation Average:5.587; most accessible tissue: Callus, score: 9.519 N N N N
vg0229153698 T -> A LOC_Os02g47680-LOC_Os02g47690 intergenic_region ; MODIFIER silent_mutation Average:5.587; most accessible tissue: Callus, score: 9.519 N N N N
vg0229153698 T -> DEL N N silent_mutation Average:5.587; most accessible tissue: Callus, score: 9.519 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0229153698 NA 1.26E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229153698 NA 1.64E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0229153698 NA 4.50E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 6.02E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 2.94E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 1.64E-10 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 8.40E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 1.89E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 2.43E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 1.14E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 7.62E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 6.25E-20 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 6.52E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 9.78E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 2.28E-06 1.49E-28 mr1164_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 3.52E-09 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 6.78E-14 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 3.25E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 2.95E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 6.17E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 5.01E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 3.94E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 2.09E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 6.99E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 3.26E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 7.38E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 1.16E-35 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 1.23E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 4.92E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 5.38E-35 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 1.90E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 2.67E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0229153698 NA 1.96E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251